7 habits of a highly successful trader mark crisp

Tài liệu 7 Habits of a Highly Successful Trader doc

Tài liệu 7 Habits of a Highly Successful Trader doc

... you are a long term trend follower then why ask a day trader? If you are a value investor then asking a momentum trader will be a total waste of time What I am saying is, no two people have the ... you are simply chasing the money it can be a motivation as long as you are motivated to learn and work at what really works in the market and NOT keep chasing the latest hot new trading idea that ... love of money to make them act I am amazed at the number of traders who have not even read a number of very basic stock market books It seems it is too much effort for them to read a book and learn...

Ngày tải lên: 13/12/2013, 00:15

31 470 0
Tài liệu 7 Habits Of A Higly Sucsessfull Trader pptx

Tài liệu 7 Habits Of A Higly Sucsessfull Trader pptx

... you are a long term trend follower then why ask a day trader? If you are a value investor then asking a momentum trader will be a total waste of time What I am saying is, no two people have the ... you are simply chasing the money it can be a motivation as long as you are motivated to learn and work at what really works in the market and NOT keep chasing the latest hot new trading idea that ... love of money to make them act I am amazed at the number of traders who have not even read a number of very basic stock market books It seems it is too much effort for them to read a book and learn...

Ngày tải lên: 11/12/2013, 16:15

31 425 0
THE 7 HABITS OF HIGHLY EFFECTIVE TEENS

THE 7 HABITS OF HIGHLY EFFECTIVE TEENS

... Original title: THE HABITS OF HIGHLY EFFECTIVE TEENS by Sean Covey Copyright © FranklinCovey Company “FranklinCovey and the FC logo and trademarks are trademarks of FranklinCovey Co and their ... tònh cẫm ca ngûúâi êëy bao vêy Hậy quan hai ngûúâi sau: Tasha vâ Brady Brady àùåt Tasha lâm trổng têm cåc àúâi mònh, vâ bẩn sệ thêëy sûå bêët ưín, mêët àưåc lêåp ca cåc àúâi Brady nhû sau: 38 Tẩo ... hiïån tẩi ca bẩn cố thïë nâo ài nû a - Stedman Graham - Tấc giẫ cën “You can make it Happen“ Lúâi giúái thiïåu Bẩn àổc thên mïën, Tíi múái lúán lâ tíi àểp nhêët vâ quan trổng nhêët ca àúâi ngûúâi...

Ngày tải lên: 24/08/2013, 08:48

110 481 0
Tài liệu 7 Habits of Highly Effective People (Stephen Covey) ppt

Tài liệu 7 Habits of Highly Effective People (Stephen Covey) ppt

... improving your professional knowledge and exercise are all examples of Quadrant activity - not an exhaustive list, by any means We all intuitively know that Quadrant activities are the key to getting ... understanding You will naturally be paying particular attention to the important areas you defined in habit 2, but you should also consider reading all the great works of literature and also ancient ... spiritual part of the habit, that is, during a meditation It is simply to commit to approaching inter-personal relationships by making use of habits 4, and Even if people approach me making use of...

Ngày tải lên: 24/01/2014, 23:20

6 671 3
THE 7 HABITS OF HIGHLY EFFECTIVE FAMILIES – 7 THÓI QUEN TẠO GIA ĐÌNH HẠNH PHÚC pdf

THE 7 HABITS OF HIGHLY EFFECTIVE FAMILIES – 7 THÓI QUEN TẠO GIA ĐÌNH HẠNH PHÚC pdf

... logo and trademarks are trademarks of FranklinCovey Co and their use is by permission All rights reserved Vietnamese Edition © 2009 by First News – Tri Viet Published by arrangement with FranklinCovey ... dạng sang hình thức hay sử dụng cho mục đích thương mại Original title: The Habits of Highly Effective Families by Stephen R Covey Copyright © 19 97 by Franklin Covey Company FranklinCovey and ... nêu trên: thay đổi thật lâu dài diễn từ bên Nói cách khác, thay cố gắng thay đổi hoàn cảnh hay thay đổi trai anh định thay đổi Từ việc thay đổi thân, anh tạo thay đổi hoàn cảnh trai Cách tiếp...

Ngày tải lên: 26/06/2014, 23:20

512 469 2
THE 7 HABITS OF HIGHLY EFFECTIVE PEOPLE - 7 THÓI QUEN ĐỂ THÀNH ĐẠT pdf

THE 7 HABITS OF HIGHLY EFFECTIVE PEOPLE - 7 THÓI QUEN ĐỂ THÀNH ĐẠT pdf

... FranklinCovey and the FC logo and trademarks are trademarks of FranklinCovey Co and their use is by permission Vietnamese Edition © 20 07 by First News - Tri Viet Published by arrangement with FranklinCovey ... tùỉc lâm trổng têm), Habits of Highly Effective Family (7 Thối quen ca gia àònh hẩnh phc), Living the Habits (Sưëng theo thối quen), The 8th Habit – from Effectiveness to Greatness (Thối quen thûá ... vâ khất vổng ca bẫn thên Thûá hai, tưi mën gúåi rùçng bẩn nïn thay àưíi mư thûác ca viïåc tham gia vâo têåp tâi liïåu nây, ngh a lâ chuín tûâ vai trô ca ngûúâi hổc sang vai trô ca ngûúâi dẩy...

Ngày tải lên: 26/06/2014, 23:20

481 634 11
Stephen R. Covey7 THÓI QUEN T O GIA ÌNH H NH PHÚCThe 7 Habits of Highly Effective pot

Stephen R. Covey7 THÓI QUEN T O GIA ÌNH H NH PHÚCThe 7 Habits of Highly Effective pot

... s i dây liên k t ang phá ho i m i quan h t o b o l c gia ình.” - Arun Gandhi, cháu trai c a Mahatma Gandhi, Nhà sáng l p Qu n lý H c vi n Gandhi Tay g p b a Thói quen t o gia ình h nh phúc s ... thân xem Anh ang t c gi n nghĩ r ng g p th t b i Anh ch c n v ang c g ng l ng nghe có th n trai m lòng c sao? Nó không bi t th c s anh ang nghĩ hay sao? Anh c n ph i c g ng nhi u n a thay i suy ... Nhưng s thay i ch di n gia ình th c s Gia ình nh ng chúng ưu tiên hàng u ta tr i qua, Văn h a gia ình t t p văn h a c a “cái chúng ta” ó chia s lo i văn h a giúp h a ng v i nhau, hư ng t i m t m...

Ngày tải lên: 09/08/2014, 02:22

26 417 0
7 habits of websavvy entrepreneurs

7 habits of websavvy entrepreneurs

... keep those negative remarks to yourself Ilya Pozin founded his first company, Ciplex, at age 17 The digital marketing and creative agency caters to small businesses and start-ups @ilyaNeverSleeps ... and helpful Be at pulse of what is happening on the Web The Web is always changing Don't get too attached to any one tool Chances are something better is going to come along There is always a ... Take a look at one of the most successful independent social media curators, such as authors @brainpicker or @MichaelHyatt with close to 200,000 Twitter followers each Both of them share great...

Ngày tải lên: 14/03/2014, 13:21

2 231 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... 1269–1 272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and ... Serratia marcescens Biochim Biophys Acta 955, 77 –85 Oda T, Kojima Y, Akaike T, Ijiri S, Molla A & Maeda H (1990) Inactivation of chemotactic activity of C 5a by the serratial 56-kilodalton protease...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

... PTDH, and an Arg replaced Ala 176 to stabilize the additional negative charge of NADP PTDH-E 175 A A 176 R displayed relaxed cofactor specicity with a Km for NADP that is decreased over 70 0-fold compared ... Table Kinetic comparison of WT and Mutant PTDH and FDH with either NADP or NAD Enzyme (cofactor) KM NADP (lM) kcat (min)1) kcat KM, WT PTDH (NAD )a WT PTDH (NADP )a E 175 A A 176 R (NAD )a E 175 A A 176 R ... data that PTDHE 175 A A 176 Rs afnity for NAD has decreased about vefold as a result of the two mutations (Table 3) Previously, using the Km values as estimates of dissociation constants, it was...

Ngày tải lên: 23/03/2014, 15:20

12 368 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 172 3 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... GTGAAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAG V K P D T M K L I V N W N G K E TTTCTCCGTGAGACTTGGACCCGTTTCATGGAAGACAGCTTCCCCATC F L R E T W T R F M E D S F P I GTGAACGATCAAGAAGTGATGGACGTGTTTCTAGTGGTGAACATGCGT...

Ngày tải lên: 20/06/2014, 01:20

11 854 0
Báo cáo hóa học: " Complete genome sequence of a highly divergent astrovirus isolated from a child with acute diarrhea" ppt

Báo cáo hóa học: " Complete genome sequence of a highly divergent astrovirus isolated from a child with acute diarrhea" ppt

... regions of basic amino acids separated by a 10 aa spacer The protein alignment of ORF 1a revealed that AstV-MLB1 has a sequence motif similar to the putative NLS of human astroviruses This region of ... to speculate that AstV-MLB1 is the pathogenic agent that caused this case of diarrhea However, whether AstVMLB1 is a bona fide human virus capable of causing diarrhea will have to be established ... [GenBank: AAD 172 24]; Human Astrovirus [GenBank: DQ 070 852]; Human Astrovirus [GenBank: DQ028633]; Human Astrovirus [EMBL: CAA86616]; Human Astrovirus [Gen Bank: AAK31913]; Human Astrovirus [GenBank:...

Ngày tải lên: 20/06/2014, 01:20

7 341 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_1 ppt

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_1 ppt

... A Year Trading Sugar Points to Remember Chapter 7: Characteristics of a Successful Trader Intimate Knowledge of Trading Signals Discipline and Patience Analysis of Self and of the Trading Plan ... necessary to know the answers I view trading as a craft A successful trader is a craftsman, applying his or her skills in the same way as a baseball pitcher who has perfected throwing a knuckleball, ... Proprietary Trading Record For the active trading years of 1981–1995 (including four years when I granted power of attorney to another trader) and again starting in 20 07, my average annual rate of return...

Ngày tải lên: 20/06/2014, 19:20

24 457 5
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_2 pdf

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_2 pdf

... may commit this very sin It is the dominant and gargantuan task of a chart trader to actually trade a market in real time in a manner even closely resembling how a market would have been traded ... idea that chart patterns are reliably predictive of future price behavior is foolhardy at best Charts are a trading tool, not a forecasting tool As a trader who has used charts for market operations ... that sell easy-money and quick-fix systems and approaches as a means to easy profits are a dishonor to the real-life challenges of trading Second, I want to communicate to nontraders and traders...

Ngày tải lên: 20/06/2014, 19:20

24 699 1
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_3 pptx

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_3 pptx

... novice traders paper-trade or trade a small trial account for a year or two prior to placing real skin in the game The Factor Trading Plan is based on a technical approach to market analysis ... Factor Trading Plan falls into a category known as discretionary (as opposed to the mechanical approach used by many technical traders) A discretionary trading plan requires that the trader makes ... no guarantee that any market will reach its target Traders need to be alert for markets that run out of steam prior to attaining a target Intervening Patterns and Pyramiding During a sustained...

Ngày tải lên: 20/06/2014, 19:20

24 381 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_4 potx

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_4 potx

... direction of any given market at any given time Classical charting can serve as the basis for creating a trading plan Successful trading plans must have precise definitions of market behavior and trading ... graph of the Australian dollar/Japanese yen (AUD/JPY) Again note the retest that occurred two weeks after the initial pattern completion As is almost always the case with valid pattern breakouts, ... Belabored patterns such as this have a way of wearing out the chart trader, who jumps the gun many times before the real trend begins Traders that attempt to anticipate a pattern completion can...

Ngày tải lên: 20/06/2014, 19:20

24 349 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_6 doc

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_6 doc

... place on Sunday afternoon (such as stops in thinly traded electronic markets) are placed early on Monday morning I am normally awake and have checked Asian and European trading by about 3:30 AM ... biggest challenge that faces me as a trader And this is a battle that never ends Existing Open Positions Among all aspects of my trading, this is the one area that causes me the most aggravation and ... significant weekly chart patterns that qualify an individual market for a trade in any given calendar year Finding more than three weekly chart patterns in a specific market even during a strongly...

Ngày tải lên: 20/06/2014, 19:20

24 238 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_8 ppt

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_8 ppt

... in DAX with an EndAround Move A trade like the DAX creates agony and makes me question my trading plan and decision making The DAX is a big contract; I had an open trade profit in the trade of ... interest in a hikkake in any market I am not trading or looking to trade The hikkake is a failed inside-bar pattern The inside bar is a candlestick formation that occurs when a day’s candle range is ... at this market during January 2010 before the market eventually topped In 2009, sugar was my single most profitable market It is not unusual for a market that causes me fits for a year or two...

Ngày tải lên: 20/06/2014, 19:20

24 238 0

Bạn có muốn tìm thêm với từ khóa:

w