3  handling the events of a map

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

... _ Step Put the tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... not, make sure to switch to the correct type of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter...

Ngày tải lên: 21/12/2013, 19:15

2 393 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

... _ Step Put the tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... not, make sure to switch to the correct type of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter...

Ngày tải lên: 18/01/2014, 04:20

2 374 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... substrate specificity and the cofactor References Hasegawa, Y., Muraki, T., Tokuyama, T., Iwaki, H., Tatsuno, M & Lau, P.C (2000) A novel degradative pathway of 2-nitorobenzoate via 3-hydroxyanthranilate ... Bacteriol 183, 5074–5081 Aoki, K., Takenaka, S., Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol Microbiol...

Ngày tải lên: 19/02/2014, 16:20

7 613 1
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

... substrate S-2444 and measurement of the increase in absorbance at 405 nm The specific inhibitory activity of PAI-1 was calculated from the amount of PAI-1 that had to be added to inhibit 50% of the ... Mab-1 The EC50 values for binding of each variant to Mab-1 or Mab-2 were determined in parallel with the EC50 value for wt and expressed as a fraction of that The means and standard deviations of ... inhibitory activity of any of the variants, and all variants had IC50 values for inactivation by XR5118 indistinguishable from that of wt (data not shown) Whereas wt PAI-1 was totally resistant to...

Ngày tải lên: 20/02/2014, 11:20

8 547 0
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc

Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc

... Approximate this map fλ2 by some analytic map g in such a way that the map g also belongs to U and the maps g and f are not conjugate Notice that all the maps of the family fλ have a critical ... properties of the quadratic maps which the ordinary unimodal maps not enjoy: • Quadratic maps are analytic and they have nondegenerate critical point; • Quadratic maps have negative Schwarzian derivative; ... not an Axiom A map We want to the same with an arbitrary unimodal map of an interval So the first reasonable question one may ask is “What makes quadratic maps so special”? Here is a list of major...

Ngày tải lên: 05/03/2014, 23:20

44 413 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx

Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx

... binding and phos4633 Kinetic mechanism for p38 MAP kinase a A E Szafranska and K N Dalby Fig Preparation of activated p38 MAPKa and ATF2D115 (A) 10% SDS ⁄ PAGE analysis showing activated, p38 MAPKa ... concentrations were approximately doubled (194 lm p38 MAPKa, 549 lm ADP, 542 lm AMP-PCP) ATPase activity assay The ATPase activity of activated p38 MAPKa was characterized using the coupled assay ... recent years p38 MAPKa has emerged as a major practicable drug target, associated with several severe diseases of inflammation [3–5] The identification in 1994 of the pyridinyl class of p38 MAPKa inhibitors...

Ngày tải lên: 16/03/2014, 22:20

15 554 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... MAPs) and stabilize them are absent in CAD cells A possible explanation is that the expression of all these MAPs is under a common regulatory mechanism Alternatively, the expression of each MAP...

Ngày tải lên: 23/03/2014, 05:22

14 416 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3-PD, acetate and ethanol are growth-associated in both the native ... rate of the recombinant culture (Jarboe et al 2010; Zhu et al 2009) The decreased μmax of the recombinant strain could also be attributed to the metabolic load imposed by the recombinant plasmid ... http://www.amb-express.com/content/1/1/37 a Page of b Figure Time course of metabolite formation by recombinant (open circles) and native strain (triangles) strains of L reuteri in batch cultivation a lactate (• ― •), acetate (―) and...

Ngày tải lên: 20/06/2014, 23:20

8 400 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... adsorbed by H The charge around the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag-H bond Due to the charge transfer from the H to the Si adatom on the ... calculating the total energy of the system including full relaxation of all Si atoms and H atoms (except for the bottom hydrogenated Si atoms) and the Ag adatom The adsorption energies (Ead) are ... models are shown in Fig The unit cell contains a slab of ˚ five Si layers (200 Si atoms) and a *12 A vacuum layer The bottom of the slab has a bulk-like structure with each Si atom saturated by an...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
Báo cáo hóa học: "GLOBAL INTEGRABILITY OF THE JACOBIAN OF A COMPOSITE MAPPING" pdf

Báo cáo hóa học: "GLOBAL INTEGRABILITY OF THE JACOBIAN OF A COMPOSITE MAPPING" pdf

... Functional Analysis 115 (1993), no 2, 425–431 [2] F W Gehring, The L p -integrability of the partial derivatives of a quasiconformal mapping, Acta Mathematica 130 (1973), 265–277 [3] J Hogan, C Li, A ... Sbordone, On the integrability of the Jacobian under minimal hypotheses, Archive for Rational Mechanics and Analysis 119 (1992), no 2, 129–143 , Weak minima of variational integrals, Journal f¨ r ... we explore applications of the new version of the H¨ lder inequality estabo lished in the last section Specifically, we study the integrability of the Jacobian of the composition of mappings f...

Ngày tải lên: 22/06/2014, 22:20

9 225 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

... genetic map of T b gam- Marker segregation proportions The availability of segregation data across the length of each chromosome allows a full analysis of the inheritance of the STIB 386 parental ... following additional data are available with this paper Additional data file provides segregation data Additional data file provides a comparison with the physical and genetic maps of T b brucei ... BLASTN search of the primers against the T brucei contigs database [55] The details of the primers used and the markers scored are provided as supplementary material (Additional data file 1) A...

Ngày tải lên: 14/08/2014, 20:22

12 281 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... that must be prevented For example, a data manager may wish to temporarily allow read-only access to cached data The locking on a page may later be changed as deemed necessary by the data manager...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...

Ngày tải lên: 21/09/2012, 10:39

386 1,2K 4
Guest the meaning of a word

Guest the meaning of a word

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

2 874 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

6 693 0
w