1 a tension reduced section for butt and scarf joints — plate

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

... backbone w angle restraints were obtained from analysis of dNa/daN ratios [38] The w angle restraint was set to )30° ± 11 0° for dNa/ daN ratios less than 1, and to 12 0° ± 10 0° for dNa/daN ratios ... Research Council of Canada, the Alberta Heritage Foundation for Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada Research Chair in Bioorganic and Medicinal Chemistry References 1 13 ... Samples were prepared using a- cyano-4hydroxycinnamic acid (Aldrich) or sinapinic acid (Aldrich) as a matrix, and fixed to a gold or stainless-steel target before analysis The instrument was calibrated...

Ngày tải lên: 07/03/2014, 15:20

9 520 0
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

... antiplatelet agents, and anticoagulants Am J Gastroenterol 2007, 10 2:507- 515 Lanas A, Garcia-Rodriguez LA, Arroyo MT, Gomollon F, Feu F, Gonzalez-Perez A, Zapata E, Bastida G, Rodrigo L, Santolaria ... Wong J, Lam SK: Celecoxib compared with lansoprazole and naproxen to prevent gastrointestinal ulcer complications Am J Med 2005, 11 8 :12 71- 1278 Lanas A, Garcia-Rodriguez LA, Arroyo MT, Bujanda L, ... of the univariate or multivariate analyses Table Multivariate analysis of significant variables and other likely causational variables for serious NSAID ulcer complications Predictor Adjusted OR...

Ngày tải lên: 09/08/2014, 10:20

8 459 0
Báo cáo y học: "κ The roles of the classical and alternative nuclear factor-κB pathways: potential implications for autoimmunity and rheumatoid arthritis" ppsx

Báo cáo y học: "κ The roles of the classical and alternative nuclear factor-κB pathways: potential implications for autoimmunity and rheumatoid arthritis" ppsx

... human rheumatoid arthritis Autoimmun Rev 2007, 7:65-70 11 4 Sato K, Suematsu A, Okamoto K, Yamaguchi A, Morishita Y, Kadono Y, Tanaka S, Kodama T, Akira S, Iwakura Y, Cua DJ, Takayanagi H: Th17 functions ... epithelial cells in the thymic medulla J Exp Med 2007, 204 :12 67 -12 72 55 Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi ... Alhawagri M, Hagen-Stapleton A, Kitaura H, Kanagawa O, Novack DV: NF-(kappa)B-inducing kinase controls lymphocyte and osteoclast activities in inflammatory arthritis J Clin Invest 2005, 11 5 :18 48 -18 54...

Ngày tải lên: 09/08/2014, 10:23

14 317 0
Guide to Design Criteria for Bolted and Riveted Joints

Guide to Design Criteria for Bolted and Riveted Joints

... Designation A3 07-8 3a, Philadelphia, 19 83 American Society for Testing and Materials, Quenched and Tempered Alloy Steel 19 85 1. 11 Bolts, Studs and Other Externally Threaded Fasteners, ASTM Designation ... 40-50 a 42-65 a 42-50 a 45-60 a 90 -10 0 a 58-80 63-70 a 60-70 a 60-80 a 63-70 a 70 -10 0 a 10 0 -13 0 a 20 18 18 15 -20 a 18 18 -22 a 17 -18 a a Fig 2.3 Minimum specified properties for structural steels ... Testing and Materials, A Guide for Fatigue Testing and Statistical Analysis of Fatigue Data, ASTM Special Technical Publication 91- A, Philadelphia, 19 63 2.7 H S Reemsnyder, “Procurement and Analysis...

Ngày tải lên: 24/10/2013, 04:15

352 562 1
aisc design criteria for bolted and riveted joints

aisc design criteria for bolted and riveted joints

... Designation A3 07-8 3a, Philadelphia, 19 83 American Society for Testing and Materials, Quenched and Tempered Alloy Steel 19 85 1. 11 Bolts, Studs and Other Externally Threaded Fasteners, ASTM Designation ... 40-50 a 42-65 a 42-50 a 45-60 a 90 -10 0 a 58-80 63-70 a 60-70 a 60-80 a 63-70 a 70 -10 0 a 10 0 -13 0 a 20 18 18 15 -20 a 18 18 -22 a 17 -18 a a Fig 2.3 Minimum specified properties for structural steels ... Testing and Materials, A Guide for Fatigue Testing and Statistical Analysis of Fatigue Data, ASTM Special Technical Publication 91- A, Philadelphia, 19 63 2.7 H S Reemsnyder, “Procurement and Analysis...

Ngày tải lên: 24/10/2014, 08:16

352 513 0
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx

Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx

... BQ -12 3 and [Ala1,3 ,11 ,15 ]ET -1 Biochem Biophys Res Commun 18 2, 14 4 15 0 40 Saeki T, Ihara M, Fukuroda T, Yamagiwa M & Yano M (19 91) [Ala1,3 ,11 ,15 ]Endothelin -1 analogs with ETB agonistic activity ... Clemens Glaubitz and Andreas Engel for valuable discussions, and we thank Walter Rosenthal for the cDNA of human ETB We further ´ thank Robert Tampe and Katrin Schulze for their help with SPR analysis ... station (GE Healthcare) The cET -1 ligand was detected by specific absorption at 550 nm Peak area values were calculated by smart manager software and plotted with kaleidagraph 3.52 software Nonspecific...

Ngày tải lên: 16/03/2014, 10:20

13 434 0
English for Tourism and Hospitality 1

English for Tourism and Hospitality 1

... EXERCISES Key vocabulary Look up the meaning and pronunciation of these words in your dictionary reservation book cost single certainly per night arrive just leave available require sure Language Point ... _ The Chant Practise saying this chant out loud Would you like two nights or would you like three? Certainly Certainly Just a minute please Answers: 1) Good morning, Plaza Hotel Leo speaking 2) ... 2) Good morning, Plaza Hotel Leo speaking How can I help you? 1) Just a minute please 2) Would you mind holding please? 3) May I put you on hold while I find out for you? 4) Can I put you on hold?...

Ngày tải lên: 05/11/2012, 09:52

2 2,9K 63
English for Tourism and Hospitality 1

English for Tourism and Hospitality 1

... N for November O for Oscar P for Papa Q for Quebec R for Romeo S for Sierra T for Tango U for Uniform V for Victor W for Whisky X for X-ray Y for Yankee Z for Zulu A for Alfa B for Bravo C for ... a minute please… Yes, we have rooms available then You require two single rooms? Mona: Thank you Leo: Can I have your name please? Mona: My name is Mona White Leo: And your father's name please, ... Just a minute please… Yes, we have rooms available then You require two single rooms? Mona: Yes, thank you Leo: Can I have your name please? Mona: My name is Mona White Leo: And your father' name,...

Ngày tải lên: 05/11/2012, 16:27

7 1K 5
Tài liệu SECTION TWO: Structure and Written Expression (1) ppt

Tài liệu SECTION TWO: Structure and Written Expression (1) ppt

... at www.tailieuduhoc.org Answer Keys A A D D B D C D B 10 B 11 B 12 B 13 B 14 C 15 B 16 A 17 D 18 A 19 D 20 A 21 A 22 A 23 D 24 A 25 B 26 B 27 D 28 B 29 B 30 C 31 A 32 B 33 D 34 C 35 A 36 A 37 B ... cherished and sought after annual award for quality (A) (B) works in the field of journalism and literature (C) (D) 17 Doctors now recommend that a balance in various activities, such as sleeping, ... of many tropical rainforest trees is hauled away by loggers, which (A) (B) (C) they use it to make planks and chopsticks in Japan (D) 28 Compared with another spiders, tarantulas actually have...

Ngày tải lên: 26/12/2013, 00:17

6 1,8K 42
Tài liệu A resource for reading and words part 1 ppt

Tài liệu A resource for reading and words part 1 ppt

... thousand members as an educational and propaganda machine Music, obviously, can make a mood, build familiarity and memory, and for an happy event He has always been to help the needy READING ... opinions, fashion, and even traditions are changing rapidly The old cannot adapt themselves to these changes easily They always talk about good old days, and grumble about the young, which leads to a ... www.elt-time.com/forum PASSAGE THE BRITISH MENTALITY Although I had stayed in England for over a year, it was difficult for me to understand the British mentality Traveling to the office everyday by train,...

Ngày tải lên: 25/01/2014, 22:20

15 718 3
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, ... morphology of aggregates formed after incubation times when the aggregation had reached a maximum [5 h for Ab(M1–40) and Ab (1 40) and 80 for Ab(M1–42) and Ab (1 42)] was assessed by negative contrast electron ... 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... A National Strategy for Prevention and Control of Hepatitis B and C http://www.nap.edu/catalog /12 793.html ACRONYMS AND ABBREVIATIONS AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API ... to readers: National hepatitis b initiative for Asian Americans/Native Hawaiian and other Pacific Islanders Morb Mortal Wkly Rep 58 (18 ):503 2009d Viral hepatitis: Statistics and surveillance...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination ... Cancer: A National Strategy for Prevention and Control of Hepatitis B and C http://www.nap.edu/catalog /12 793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV ... and Quality acquired immunodeficiency syndrome alanine aminotransferase Hepatitis B core antibody Hepatitis B surface antibody Hepatitis C antibody Asian and Pacific Islander aspartate transaminase...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx

Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx

... decreased luciferase activity was observed with 10 lM SB203850 and this appeared to reach a plateau by 10 0 lM With PD098059 and UO126 a variable effect was observed at 10 lM and by 10 0 lM a marked repression ... synthase FEBS Lett 547, 75–79 20 Nasuhara, Y., Adcock, I.M., Catley, M., Barnes, P.J & Newton, R (19 99) Differential IkappaB kinase activation and IkappaBalpha degradation by interleukin-1beta and ... contact with airborne allergens, irritants, pathogens and other proinflammatory agents that trigger exacerbation in airway diseases [15 ] This epithelium is biosynthetically active and acts as a...

Ngày tải lên: 07/03/2014, 15:20

7 379 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

... to 15 lm for P50H, H50P, P128H, H128P, PigE17DCPT1B and HumanD17ECPT1B, and from to 500 lm for D18PigCPT1B and D28PigCPT1B) The assay was performed at mm carnitine as standard To analyze PigE17DCPT1B ... construct HMCPT1–pHWO10 was used as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH677 (5¢-TTCCT CATCATCCAACAAGGG-3¢) The PCR reaction yielded a 610 -bp product ... characteristics of recombinant pig CPT 1A and CPT1B can explain these peculiarities [10 ,23], we speculate that the single amino acid variation observed between pig and human (Asp17 for human and...

Ngày tải lên: 16/03/2014, 04:20

9 551 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... Iowa Margaret L Brandeau Professor, Department of Management Science and Engineering, Stanford University, Stanford, California Daniel R Church Epidemiologist and Adult Viral Hepatitis Coordinator, ... specific at-risk populations room as soon as they are stable and washed School-entry mandates have been shown to increase hepatitis B vaccination rates and to reduce disparities in vaccination rates ... hepatitis B and hepatitis C are important public health problems and that there are several barriers to prevention and control efforts, such as a lack of knowledge and awareness about chronic...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
Báo cáo khoa học: Colocalization of insulin receptor and insulin receptor substrate-1 to caveolae in primary human adipocytes Cholesterol depletion blocks insulin signalling for metabolic and mitogenic control doc

Báo cáo khoa học: Colocalization of insulin receptor and insulin receptor substrate-1 to caveolae in primary human adipocytes Cholesterol depletion blocks insulin signalling for metabolic and mitogenic control doc

... of ATP, insulin, and GTPcS and localization of GLUT4 to clathrin lattices J Cell Biol 11 7, 11 81 11 96 McKeel, D.W & Jarett, L (19 70) Preparation and characterization of a plasma membrane fraction ... crossreacting with and detecting an unrelated plasma membrane/caveolae protein Moreover, transfected cells expressed HA-IRS1 in the caveolae and the plasma membrane as analyzed with antibodies against ... the same treatment no IRS1 was associated with the plasma membrane in rat epididymal adipocytes In rat adipocytes (herein and [18 ]) and other cells [19 – 21] IRS1 has been shown not to be associated...

Ngày tải lên: 23/03/2014, 12:20

9 424 0
Báo cáo khoa học: "Reduced n-gram models for English and Chinese corpora" ppt

Báo cáo khoa học: "Reduced n-gram models for English and Chinese corpora" ppt

... Brown 19 97 Language Modeling using Stochastic Automata with Variable Length Contexts Computer Speech and Language, volume 11 , pages 1- 16 314 Joshua Goodman and Jianfeng Gao 2000 Language Model ... 3, pages 14 47 -14 50 Rhodes Thomas R Niesler and Phil C Woodland 19 96 A Variable-Length Category-Based N-Gram Language Model ICASSP’96, volume 1, pages 16 4 -16 7 Thomas R Niesler 19 97 Category-based ... by Ha et al (2002) WSJ reduced bigram, trigram, 4-gram and and the most common WSJ reduced unigrams, 5-gram curves become almost parallel and bigrams and trigrams are shown in Table It straight,...

Ngày tải lên: 23/03/2014, 18:20

7 273 0
w