A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process

Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

... O2S was synthesized by PCR using two primers: Amyb1: 5¢-ACCCTCGAGGTCGA CGGTATCGATAAGCTTGATTGACTTGACCGTCA TCGGATTGACTTGACCGTCATCG-3¢,Amyb2:5¢-CA GGATCCATCACGACAGTCAGTGCCGATGACGG TCAAGTCAATCCGATG-3¢ ... the amino acids within the binding domain of RAMY protein and analyzed the time course for the induction of RAMY a nd a- amylase mRNA by GA. Correspondence to Q. Yao, Shanghai Key Laborat...

Ngày tải lên: 16/03/2014, 18:20

7 359 0
Bacillus thuringiensis   a new perspective for an induced protection to coffee leaf rust

Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust

... 5 semanas. A prote9ao observada foi sistemica. O indice de prote^ao foi determinado peia redugao do numerc medio de lesoes por folha. Uma redu^ao no tamanho das lesoes nas folhas tratadas, bem ... predisposi- tion to infection by other pathogens, have led plant pathologists to intensify the search for alternative controls. Several authors have found that plants can be induced to be re...

Ngày tải lên: 05/05/2014, 08:45

12 421 0
Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc

... of practice. In addition the PRCA’s Consultancy Management Standard (CMS) is an external assessment based on business proficiency and all members must pass in order to join the trade association. ... of any discipline. Account teams within a full service consultancy, for instance, might undertake corporate, consumer, trade, financial or even crisis management PR according to a c...

Ngày tải lên: 13/12/2013, 04:15

2 683 1
Introduction to Cost and Management Accounting in a Global Business Environment

Introduction to Cost and Management Accounting in a Global Business Environment

... plans, and engaging in investor relations. Financial Accounting compiles, analyzes, and provides financial information to group management in respect to domestic and international operations as ... banking or in- surance) may mandate financial accounting practices. In other cases, financial ac- counting information is required for obtaining loans, preparing tax returns, and un- de...

Ngày tải lên: 18/12/2013, 09:13

38 756 2
Using peer interaction activities to teach english speaking skill in the tenth form class = sử dụng các hoạt động tương tác giữa học sinh lớp 10 để dạy kỹ năng nói tiếng anh luận văn tốt nghiệp đại học

Using peer interaction activities to teach english speaking skill in the tenth form class = sử dụng các hoạt động tương tác giữa học sinh lớp 10 để dạy kỹ năng nói tiếng anh luận văn tốt nghiệp đại học

... to be taught, they seek to stimulate or at least maintain the students’ interest in what is to be taught, to motivate students to learn, to enhance and maintain the learner's interest, including ... of peer interaction in language teaching is increasing learners' participation. In a teacher-dominated class, few students have chance to interact with the teacher...

Ngày tải lên: 19/12/2013, 11:30

67 1,2K 10
Tài liệu A New Angle on Sovereign Credit Risk - E-RISC: Environmental Risk Integration in Sovereign Credit Analysis ppt

Tài liệu A New Angle on Sovereign Credit Risk - E-RISC: Environmental Risk Integration in Sovereign Credit Analysis ppt

... environmental degradation, separate carbon from Footprint of production, incorporate additional measures of degradation Increase sophistication of analysis regarding carbon pricing, trading, or taxing. Systematise ... situation Ecological Footprint and biocapacity Non-renewable natural resources Using Input-Output analysis to analyse resource use in the economy Better integration...

Ngày tải lên: 16/02/2014, 03:20

40 397 0
Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf

... most appropriate parsing algorithm to take advantage of the information that a semantic head provides. For example, a head usually provides information about the remaining daughters that the ... to the proposals of Dowty, Reape, and Kathol, and to the particular analysis implemented here, is the characterization of nat- ural language syntax in terms of two interrelated but...

Ngày tải lên: 20/02/2014, 18:20

7 397 0
Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

... Manuals in a Monte-Carlo Framework S.R.K. Branavan David Silver * Regina Barzilay Computer Science and Artificial Intelligence Laboratory Massachusetts Institute of Technology {branavan, regina}@csail.mit.edu * ... Regina Barzilay. 2010. Reading between the lines: Learning to map high-level instructions to commands. In Proceedings of ACL, pages 1268–1277. S.R.K. Branavan, David Silve...

Ngày tải lên: 07/03/2014, 22:20

10 508 0
w