Exploring the contexts of relationship between in house prostitutes and surrounding community a case in mekabir sefer

Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx

Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx

... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war-...

Ngày tải lên: 22/02/2014, 03:20

8 690 1
EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES

EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES

... of tyrosine kinase inhibitors 110 5.3.2 Potential effect of enzyme inducer/inhibitor on pharmacokinetics of tyrosine kinase inhibitors 113 5.3.3 Effect of tyrosine kinase inhibitors ... Overcoming tyrosine kinase inhibitors- induced hepatotoxicity 160 6.5.1 Switching tyrosine kinase inhibitors 161 6.5.2 Alternative dosing 161 6.5.3 Reversibility of toxi...

Ngày tải lên: 09/09/2015, 08:14

254 1K 0
The effects of capital structure on firm performance and firm transparency  a study of firms listed in ho chi minh stock exchange (hose)

The effects of capital structure on firm performance and firm transparency a study of firms listed in ho chi minh stock exchange (hose)

... EFFECTS OF CAPITAL STRUCTURE ON FIRM PERFORMANCE AND FIRM TRANSPARENCY: A STUDY OF VIETNAMESE ON- GOING FIRMS LISTED IN HO CHI MINH STOCK EXCHANGE (HOSE) In Partial Fulfillment of the Requirements ... financial transparency index and firm performance? Research Objectives Generally, this thesis is an empirical study of effects o...

Ngày tải lên: 22/10/2015, 11:32

72 742 1
báo cáo hóa học:" Salter-Harris II injury of the proximal tibial epiphysis with both vascular compromise and compartment syndrome: a case report" docx

báo cáo hóa học:" Salter-Harris II injury of the proximal tibial epiphysis with both vascular compromise and compartment syndrome: a case report" docx

... This is the first reported case with both vascular compromise and compartment syndrome secondary to a proximal tibial Salter-Harris injury An epidemiological study of epiphyseal growth plate injuries ... Burkhart SS and Peterson HA: Fractures of the proximal tibial epiphysis J Bone Joint Surg Am 1979, 61(7):996–1002 Shelton WR and Canale ST: Fractures...

Ngày tải lên: 20/06/2014, 04:20

5 420 0
báo cáo khoa học: "The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention" pps

báo cáo khoa học: "The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention" pps

... article as: James: The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention Implementation Science ... language delay/disorder: A meta-analysis Journal of Speech Language and Hearing Research 2004, 47:924-943 18 Lewison G, Carding P: Evaluating...

Ngày tải lên: 10/08/2014, 11:20

10 601 0
GRADUATION THESIS THE IMPACT OF VIETNAM – EU FREE TRADE AGREEMENT ON GEOGRAPHICAL INDICATIONS:  A CASE STUDY OF HUNG YEN LONGAN

GRADUATION THESIS THE IMPACT OF VIETNAM – EU FREE TRADE AGREEMENT ON GEOGRAPHICAL INDICATIONS: A CASE STUDY OF HUNG YEN LONGAN

... increase the competitive advantages of Geographical indications – Hung Yen Longan of Vietnam in the Vietnam – EU free- trade agreement? ” In doing so, the author firstly analyzes the scale of VEFTA as ... Analyzing the trade scale between Vietnam and EU, the article Geographical indication in VEFTA and the background on geographical - i...

Ngày tải lên: 10/08/2016, 16:48

92 821 0
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

... two annotation standards are naturally denoted as source standard and target standard, while the classifiers following the two annotation standards are respectively named as source classifier and ... for Segmentation and Tagging Table also lists the results of annotation adaptation experiments For word segmentation, the model after annotation adaptation (row in upper...

Ngày tải lên: 17/03/2014, 01:20

9 404 0
Báo cáo y học: "Rare ileal localisation of angiolipoma presenting as chronic haemorrhage and severe anaemia: a case report" ppsx

Báo cáo y học: "Rare ileal localisation of angiolipoma presenting as chronic haemorrhage and severe anaemia: a case report" ppsx

... is novel Case presentation An 80-year-old man who underwent triple aortocoronary bypass surgery was affected by an aneurysm of the abdominal aorta, bilateral obstructive arteriopathy of the lower ... histological pre-operative diagnosis was not defined Figure it ment as appeared during with a hypervascularised baseIleal polypoid neoformationretrograde ileoscopy Ileal polypoid neof...

Ngày tải lên: 11/08/2014, 23:21

4 215 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

... unable to say at this stage (26 – 39%) Statistical modelling The final stage of analysis focuses on the modelling of intentions and working as a nurse The relationships between intentions expressed ... Figure Path model of job satisfaction, future intentions and nursing at 18 months and years Path model of job satisfaction, future intentions and nursing...

Ngày tải lên: 18/06/2014, 17:20

12 530 0
Báo cáo y học: "Genomic analysis of the relationship between gene expression variation and DNA polymorphism in Drosophila simulans" pps

Báo cáo y học: "Genomic analysis of the relationship between gene expression variation and DNA polymorphism in Drosophila simulans" pps

... 8.95) These cut-offs are arbitrary and chosen because they resulted in about half of the genes falling into 'average' gene expression and the remainder of the genes falling roughly equally into ... and that inclusion of these genes in the analysis may obscure an effect Thus, we repeated the analysis with the 500 genes with the strongest differences in...

Ngày tải lên: 14/08/2014, 20:22

14 391 0
Co-relationship between teacher-related factors and student's motivation in the context of Lomonoxop school, Hanoi = Quan hệ tương hỗ giữa yếu tố giáo viên và đ

Co-relationship between teacher-related factors and student's motivation in the context of Lomonoxop school, Hanoi = Quan hệ tương hỗ giữa yếu tố giáo viên và đ

... are in almost total control of the running of the classroom, including setting and enforcing rules, establishing procedures and organizing grouping activities These in turn greatly influence the ... context of Lomonoxop school, Ha Noi QUAN HỆ TƯƠNG HỖ GIỮA YẾU TỐ GIÁO VIÊN VÀ Đ NG LỰC HỌC TẬP CỦA HỌC SINH TRONG NGỮ CẢNH TRƯỜNG THPT DÂN LẬP LÔMÔNÔXỐP, HÀ NỘI M.A TH...

Ngày tải lên: 28/03/2015, 09:42

63 578 0
The mediating role of relationship quality in the relation between relationship benefits and word of mouth a study of the airlines ticket service

The mediating role of relationship quality in the relation between relationship benefits and word of mouth a study of the airlines ticket service

... mouth in business Specifically, the study indicates the relations between relationship benefits constructs and relationship quality and between relationship quality and word of mouth The study also ... 4.1 The revised research model 43 ABTRAST This study examines the mediating role of relationship quality in the relations between...

Ngày tải lên: 12/08/2017, 21:35

88 427 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
w