Operations Risk Managing a key Corrponent of Oeperational Risk

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindII...

Ngày tải lên: 06/03/2014, 01:20

12 454 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

... ensure the generation of the ketone The ability of ScPDC and ZmPDC to decarboxylate indolepyruvate was examined under the same conditions In the case of ZmPDC maximum enzyme concentration was 2.3 ... independent of the concentration of the auxiliary enzyme, confirming that the coupled assay monitors the true rate of EcIPDC catalysis Figs and and Table illustr...

Ngày tải lên: 08/03/2014, 02:20

10 430 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... impact on the crystallinity of untreated Avicel Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quantifying the contribution of amorphous cellulose ... such dramatic drops in the rate Constant crystallinity and decreased rates indicate surface changes on cellulose that start rapidly after the beginning of hyd...

Ngày tải lên: 15/03/2014, 10:20

12 554 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

... Brazil, France, Reunion Island Japan Spain Italy, Mexico, Poland, USA Brazil Japan Bulgaria, Canada, France, Germany, Greece, USA, Italy, Japan, Lebanon, the Netherlands, Poland, Russia, Spain, Switzerland, ... Kume H, Kawamura Y, Kanzawa N, Nakauchi Y, Kimura S, Kawashima S & Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal muscle Skeletal...

Ngày tải lên: 23/03/2014, 10:21

10 350 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

... years has led us to consider again this point: can the succession of short hypoxia and reoxygenation phases, typical of intermittent hypoxia, also stabilize HIF- 1a and activate HIF-1? In the absence ... hypoxia in cancer S Toffoli and C Michiels Fig Effects of intermittent hypoxia and chronic hypoxia on HIF- 1a stabilization and HIF-1 target gene transcri...

Ngày tải lên: 30/03/2014, 04:20

12 390 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

... multicellular organisms [15] There are four isoforms (A D) of mammalian MEF2, and they have high homology within the 56-amino-acid MADS box at their N-termini and within an adjacent 29 -amino-acid region ... as the MEF2 domain The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role in DNA binding affinity as well as an indirect rol...

Ngày tải lên: 30/03/2014, 20:20

10 437 0
Báo cáo y học: "Balance between survivin, a key member of the apoptosis inhibitor family, and its specific antibodies determines erosivity in rheumatoid arthritis" ppt

Báo cáo y học: "Balance between survivin, a key member of the apoptosis inhibitor family, and its specific antibodies determines erosivity in rheumatoid arthritis" ppt

... mortality of patients with rheumatoid arthritis J Rheumatol 2000, 27:2283-2284 30 Kamihira S, Yamada Y, Hirakata Y, Tomonaga M, Sugahara K, Hayashi T, Dateki N, Harasawa H, Nakayama K: Aberrant ... survivin relate to the nonerosive course of RA An ELISA was used for the evaluation of antibodies against survivin of IgG and IgM isotypes in plasma and in synovial fluid...

Ngày tải lên: 09/08/2014, 06:22

10 505 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

... UCSC annotated sequences (UCSC Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other ... pre-miR-30d, RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacture...

Ngày tải lên: 09/08/2014, 23:20

13 365 0
báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx

báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx

... ripening-associated patterns for aromatic and branched chain amino acid-, fatty acid-, and furanrelated classes, with a peak at the S3/Br stages and a more or less pronounced decline at later ripening ... The data set was made up of data from eight repetitions of each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA invo...

Ngày tải lên: 11/08/2014, 11:21

14 303 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

... GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, ... HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C NCOA3-D NR...

Ngày tải lên: 14/08/2014, 20:22

14 331 0
Mobility is a key predictor of change in well being among older adults who experience falls  evidence from the vancouver falls prevention clinic cohort

Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort

... the data ACCEPTED MANUSCRIPT Mobility predicts wellbeing among older fallers Mobility is a key predictor of changes in wellbeing among older fallers: Evidence from the Vancouver Falls Prevention ... MANUSCRIPT Mobility predicts wellbeing among older fallers We conducted a longitudinal analysis of data from a 12-month prospective cohort st...

Ngày tải lên: 25/08/2016, 22:07

29 342 0
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

... evolution, innovation, computation, and markets In this report, Toward a New Literacy of Cooperation in Business: Managing Dilemmas in the 21st Century, we take the first steps in exploring this emerging ... • The balance between public and private knowledge is a key variable in maintaining cooperative patterns Toward a New Literacy of Cooperat...

Ngày tải lên: 18/02/2014, 00:20

67 893 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A,...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Nitrosamine and related food intake and gastric and oesophageal cancer risk: A systematic review of the epidemiological evidence ppt

Nitrosamine and related food intake and gastric and oesophageal cancer risk: A systematic review of the epidemiological evidence ppt

... may be related to salt and NOC, in enhancing carcinogenesis after the epithelium is damaged[8] The aim of this article is to review and evaluate the available epidemiological evidence about the ... association between dietary exposure to preformed nitrosamine and related food intake and gastric and oesophageal cancer risk in humans MATERIALS AND MET...

Ngày tải lên: 06/03/2014, 02:21

8 559 0
w