... 800 (806) Ethernet (E0) Ethernet (E1) 1600 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 1700 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 2500 Ethernet (E0) Ethernet (E1) ... and view the running configuration file a Configure the router with the information in the table b Enter show running-config at the router prompt The router will display information on...
Ngày tải lên: 18/01/2014, 04:20
... 800 (806) Ethernet (E0) Ethernet (E1) 1600 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 1700 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 2500 Ethernet (E0) Ethernet (E1) ... and Routing Basics v 3.0 - Lab 5.1.3 Copyright 2003, Cisco Systems, Inc Step Create the statements to perform the following functions a Assuming in the previous step, the config-reg...
Ngày tải lên: 18/01/2014, 04:20
Leveled vocabulary readers kindergarten k 1 3 plain and fancy WORDLESS
Ngày tải lên: 26/10/2016, 11:26
Tiet 1-3 NC - KHÁI QUÁT VĂN HỌC VIỆT NAM TỪ CÁCH MẠNG THÁNG TÁM 1945 ĐẾN HẾT THẾ KỶ XX
... với khái niệm công cụ - Nhiều trường phái lí luận VH phương Tây dịch giớ thiệu - Lối phê bình xã hội học dung tục hẳn So sánh để thấy khác văn học từ 1745 đến 1975 văn học từ 1975 đến hết TK XX? ... thể loại, thi pháp phong cách nghệ thuật II NHỮNG THÀNH TỰU CHỦ YẾU VÀ MỘT SỐ HẠN CHẾ CỦA VĂN HỌC GIAI ĐOẠN TỪ 1975 ĐẾN HẾT THẾ KỈ XX : 1/ Đổi ý thức nghệ thuật...
Ngày tải lên: 13/09/2013, 20:10
tuần 1-3.Sinh hoạt tập thể
... tập, nhóm học tập II.NỘI DUNG HOẠT ĐỘNG THẦY HOẠT ĐỘNG TRÒ 1.SƠ KẾT: *Yêu cầu tổ trưởng lần *Tổ trưởng báo cáo lượt báo cáo tình hình hoạt động -Học tập (Nêu kết học tập tổ,lớp trưởng tổng hợp số ... HIỆU TUẦN SINH HOẠT LỚP Tiết 12 Trang GV: KIẾN VĂN LINH 3A Ngày 18/5/2010 I/MỤC TIÊU: -Tham gia phong trào giữ gìn trường lớp đẹp -Xây dựng nề nếp lớp -Xây dựng đôi bạn học tập, nhóm họ...
Ngày tải lên: 16/09/2013, 17:10
Period: 41- Lesson C.ON THE MOVE(1-3)
... Match mean of transportation with the correct words motorbike car train bus bike plane (to) walk Unit 7: Lesson 5: C1-3/ p.78-80 *Now ask and answer questions about these people LIEN - How does Lien ... •a5.Is there……….flower garden near your house? • a.a b.an c .the a - Learn by heart model sentences and vocabulary - Practice with a partner: Ask and answer about means of transportation...
Ngày tải lên: 24/10/2013, 05:11
de thi hoc k 1 lop 3
... k tên Đọc tiếng Học sinh bốc thăm chọn sau Đọc trả lời câu hỏi theo yêu cầu giám thò - Nắng phương Nam 94 - Người Tây Nguyên 10 3 - Người liên lạc nhỏ 11 2 - Hũ bạc người cha 12 1 - Đôi bạn 13 0 ... người sợ không tiền để trả lại cho mẹ B.Thực hành tập sau ( đ ) Câu 1/ Đặt câu theo mẫu : Ai-thế ? a.Miêu tả người đoạn b.Miêu tả người đoạn Câu 2 /K tên thành ... , b , c Câu 2/Khi ông...
Ngày tải lên: 07/11/2013, 00:11
LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 1-3
... stretched out to him, he set off in my company for his chambers And that was how a great scandal threatened to affect the kingdom of Bohemia, and how the best plans of Mr Sherlock Holmes were beaten ... over the cleverness of women, but I have not heard him it of late And when he speaks of Irene Adler, or when he refers to her photograph, it is always under the honorable title of...
Ngày tải lên: 08/11/2013, 02:15
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... 14-48 form the small insertion domain that comprises a short a- helix and a three-stranded anti-parallel b-sheet; the remaining protein residues form the (a ⁄ b)8 barrel domain and a C-terminal extension ... would act as a regulatory link between glycolysis and NAD synthesis The structure of hACMSD in complex with DHAP may used for the design o...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
... report the crystal structure of the intact glutaminase under four different conditions: in the absence of the additives (referred to as N); in the presence of Tris (referred to as T); in the presence ... determined the F structure containing the truncated region of the C-terminal domain; however, we failed to determine the structure of th...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... in lectins and haemagglutinin) where Carbohydrate binding sites in Candida exoglucanase shallow indentations contrast with the deeper clefts found in the active sites of carbohydrate processing ... interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx
... product, SLex, on the glycans of cell-surface receptors Increased expression and phosphorylation of insulinsignaling molecules leads to the facilitation of insulin signaling These findings provide ... pathogenesis of diabetes In summary, the cDNA of a1,3-FucT-VII is able to regulate the phosphorylation and expression of some signaling molecules in the InR pathw...
Ngày tải lên: 16/03/2014, 12:20