Runge Kutta methods for DAEs A new approach

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... CatD (10 ng) Values are mean ± SD, n ¼ (Insertion: 10 ng CatE and CatD and ng antigenic peptide were incubated on an ELISA plate CatE and CatD antibodies were used for the detection at dilutions ... ⁄ well) Monospesific antibodies were preincubated with different concentrations of CatE or CatD, before standard ELISA ELISA was performed as described in Experimental procedures The incr...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC- 3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted in...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot

Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot

... Improved Location aided Cluster based Routing Protocol; LAR: Location Aided Routing; LACBER: Location Aided Cluster Based Energy-efficient Routing; MOBIC: Mobility Metric Based Algorithm; RREP: Routing ... Neighbor table is a conceptual data structure for formation of a cluster whereas Cluster Adjacency Table (CAT) is used for keeping information about...

Ngày tải lên: 21/06/2014, 03:20

10 482 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

... USA, May–June 1999 Estimation of Instantaneous Mean Frequency [10] H K Kwok and D L Jones, “Improved instantaneous frequency estimation using an adaptive short-time Fourier transform,” IEEE Trans ... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identification for no...

Ngày tải lên: 23/06/2014, 01:20

8 355 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

... adherent monocytes using the Pittsburgh Protocol in roller bottle cultures in Generation Generation of phenotypically mature mDC from adherent monocytes using the Pittsburgh Protocol in roller bottle ... flasks Roller bottles Roller bottles Figure static flask of phenotypically mature mDC from adherent monocytes using ITIP in roller bottle culture...

Ngày tải lên: 11/08/2014, 10:23

11 469 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGC...

Ngày tải lên: 13/11/2014, 10:46

144 306 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

... rst total synthesis of (±)- heptemerone G (2) and in a synthesis of the (±)- guanacastepene precursor Key features of the synthesis include an efficient new synthetic sequence for annulation of ... Scheme Highlights of the proposed scheme for the synthesis of We now report the rst total synthesis of heptemerone G (2) and, en route, a...

Ngày tải lên: 26/01/2016, 09:27

3 548 0
Performance management a new approach for driving business results

Performance management a new approach for driving business results

... a new book entitled Performance Management: A New Approach for Driving Business Results by Elaine Pulakos Pulakos provides the best information we have concerning research on performance management ... performance management system What Makes Performance Management So Hard? There are genuine reasons why both managers and employees have difficulties with perfo...

Ngày tải lên: 25/11/2016, 09:40

207 477 0
A New Approach to Quantum Theory

A New Approach to Quantum Theory

... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... give an excellent analytic historical account in Variational Principles in Dynamics and Quantum Theory (Saunders, Philadelphia, 3rd edn., 1968) xii Feynman’s Thesis — A New...

Ngày tải lên: 06/11/2012, 11:21

142 574 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... adjectives with the definitions of adjectives and their semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives ... Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Tài liệu Design for Sustainability a practical approach for Developing Economies doc

Tài liệu Design for Sustainability a practical approach for Developing Economies doc

... Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, ... information on D4S 7> D4S Case studies in Developing Economies 7.1_ Building the D4S team at Fabrica Venus, Guatemala 7.2_ SWOT, Impact analysis and D4S Strategies at Talleres REA...

Ngày tải lên: 21/02/2014, 05:20

128 514 0
w