A graphical method of comparing

Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt

Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt

... Tutorial Dialogue Systems International Journal of Artificial Intelligence in Education, 16 C Rich and C L Sidner 1998 COLLAGEN: A Collaboration Manager for Software Interface Agents User Modeling and ... User-Adapted Interaction, 8(3-4) M Rotaru and D Litman 2006 Exploiting Discourse Structure for Spoken Dialogue Performance Analysis In Proc of EMNLP M Walker, D Litman, C...

Ngày tải lên: 20/02/2014, 12:20

8 517 0
báo cáo khoa học: "A novel method of cultivating cardiac myocytes in agarose microchamber chips for studying cell synchronization" ppt

báo cáo khoa học: "A novel method of cultivating cardiac myocytes in agarose microchamber chips for studying cell synchronization" ppt

... Time-course of oscillation of cardiac myocytes shown in Fig (B) (D): Optical micrograph of 24-h cultivation of two sets of the synchronized pairs (E): Time-course of oscillation of cardiac myocytes ... etching technology with which to create agarose microchambers for growing networks of cardiac myocyte cells Using the system, we first observed the differences...

Ngày tải lên: 11/08/2014, 00:22

4 229 0
Báo cáo y học: "A simpler method of preprocessing MALDI-TOF MS data for differential biomarker analysis: stem cell and melanoma cancer studies" pptx

Báo cáo y học: "A simpler method of preprocessing MALDI-TOF MS data for differential biomarker analysis: stem cell and melanoma cancer studies" pptx

... Tong et al.: A simpler method of preprocessing MALDI-TOF MS data for differential biomarker analysis: stem cell and melanoma cancer studies Clinical Proteomics 2011 8:14 Submit your next manuscript ... identification of candidate markers based on differential analysis of MALDI-TOF MS data Our data preprocessing approach was simple and yet effe...

Ngày tải lên: 13/08/2014, 13:21

18 334 0
Hướng dẫn bói bài Tarot A french method of fortune telling by cards

Hướng dẫn bói bài Tarot A french method of fortune telling by cards

... a lady, and the issue will be daughters only; if a man, it is destined that he will make a rich and happy marriage Page of 10 A. E Waite, A French Method of Fortune Telling Manual of Cartomancy ... gift, or as it is called somewhat conventionally the clairvoyant faculty of the operator Page of 10 A. E Waite, A French Method of Fortune Telling Manual of Ca...

Ngày tải lên: 17/02/2016, 09:26

10 453 0
a rapid method for estiminating of noise expouse workplace

a rapid method for estiminating of noise expouse workplace

... Golmohammadi R et al: A Rapid Method for Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monitoring and controlling of noise According ... in a workplace contain follows: The quality of wall sound absorption The quality of ceiling sound absorption The quality of roof sound absorption Mean of noise...

Ngày tải lên: 05/09/2013, 13:23

7 418 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... influence a substrate has on its own removal It is obtained for all substrates of any elementary reaction The main point of the present section is that any Jacobian matrix element equals the sum of a ... is the basis of the graphical analyses of the characteristic equation and of the method we develop here Inspection of Eqn 12 shows that in all coefficients a...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

... -22.37 Table 1: Interpretations of Lapata and Lascarides (2003) for finish video Lapata and Lascarides (2003) extend Utiyama’s approach to interpretation of logical metonymies containing aspectual ... European Chapter of the ACL, pages 168–177, Utrecht M Lapata and A Lascarides 2003 A probabilistic account of logical metonymy Computational Linguistics, 29(2):261–315 A Las...

Ngày tải lên: 20/02/2014, 09:20

9 429 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

... new method for measuring strength of lexical association for candidate phrasal terms based upon the use of Zipfian ranks over a frequency distribution combining n-grams of varying length The method ... study examined the performance of various association metrics on a corpus of 6.7 million words with a cutoff of N=10 The resulting n-gram set had a maximum recall of 2...

Ngày tải lên: 08/03/2014, 04:22

9 507 1
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

... simplied rate laws for the construction of the Jacobian matrix used for the analysis of stability Enzymatic rate laws and other details of the full kinetic model are given in Appendix S1 Comparing ... and detailed rate laws (hybrid model, values in bold) The heading designates the type of load parameter varied and the range of variation relat...

Ngày tải lên: 23/03/2014, 06:20

15 456 0
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

... kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% 11.4% ... speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams for each part of speech in the infresyllabaries: The former is used primar...

Ngày tải lên: 23/03/2014, 19:20

8 397 0
Fermentation as a Method of Food Processing ppt

Fermentation as a Method of Food Processing ppt

... standard of a food is based on the processing and handling of the food, as well as on the conditions of the raw materials A food item prepared with water contaminated with pathogenic microorganisms ... standard of a food is based on the processing and handling of the food, as well as on the conditions of the raw materials A food item prepared from wat...

Ngày tải lên: 24/03/2014, 04:20

65 539 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

... expertise for child survival and maternal health within USAID Bureau for Asia and the Near East Bureau for Africa Bureau for Latin America and the Caribbean Oversee all country and regional missions ... the Child Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide- ranging efforts to lower maternal and child mortality in...

Ngày tải lên: 28/03/2014, 09:20

64 380 0
w