Red book atlas of pediatric infectious diseases 2013

The Management of Community-Acquired Pneumonia in Infants and Children Older Than 3 Months of Age: Clinical Practice Guidelines by the Pediatric Infectious Diseases Society and the Infectious Diseases Society of America pot

The Management of Community-Acquired Pneumonia in Infants and Children Older Than 3 Months of Age: Clinical Practice Guidelines by the Pediatric Infectious Diseases Society and the Infectious Diseases Society of America pot

... Seasonal in uenza in adults and children: diagnosis, treatment, chemoprophylaxis, and institutional outbreak management: clinical practice guidelines of the Infectious Diseases Society of America Clin ... the American Thoracic Society, the Society for Hospital Medicine, and the Society of Critical Care Medicine The guidelines were reviewed and...

Ngày tải lên: 28/03/2014, 09:20

52 840 1
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... CGGTTTGTTTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions ... doi:10.1186/1423-0127-18-41 Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infe...

Ngày tải lên: 10/08/2014, 05:21

11 527 0
Báo cáo y học: " Prospects for control of emerging infectious diseases with plasmid DNA vaccines" doc

Báo cáo y học: " Prospects for control of emerging infectious diseases with plasmid DNA vaccines" doc

... elicited by vaccination For DNA vaccines, various delivery systems and adjuvants have been tested One of the earliest promising adjuvants for plasmid DNA vaccines was poly-lactide coglycolide (PLG), ... rates of autoimmunity or anti -DNA antibodies such as those observed in Systemic Lupus Erythematosis have not been observed in clinical trials of DNA vaccination [12] Intere...

Ngày tải lên: 11/08/2014, 08:21

9 286 0
Surgical Atlas of pediatric otolaryngology - part 1 docx

Surgical Atlas of pediatric otolaryngology - part 1 docx

... 1- 5 500 9 -1 3 3-6 Printed in Canada Sales and Distribution United States BC Decker Inc P.O Box 785 Lewiston, NY 14 09 2-0 785 Tel: 90 5-5 2 2-7 017 / 1- 8 0 0-5 6 8-7 2 81 Fax: 90 5-5 2 2-7 839 / 1- 8 8 8-3 7 7-4 987 E-mail: ... 90 5-5 2 2-7 017 ; 1- 8 0 0-5 6 8-7 2 81 Fax: 90 5-5 2 2-7 839; 1- 8 8 8-3 7 7-4 987 E-mail: info@bcdecker.com Website:...

Ngày tải lên: 11/08/2014, 11:22

85 328 2
Surgical Atlas of pediatric otolaryngology - part 2 pptx

Surgical Atlas of pediatric otolaryngology - part 2 pptx

... cholesteatoma developed in 38% of cases and 23 % of those cholesteatomas were detected at the time of the “second look” procedure.4 1 02 Surgical Atlas of Pediatric Otolaryngology Residual or recurrent ... Otorhinolaryngol 20 00; 52: 269–76 Mishiro Y, Sakagama M, Okumura S, et al Postoperative results for cholesteatoma in children Auris Nasus Larynx 20 00 ;27 :22 3–6 Sivol...

Ngày tải lên: 11/08/2014, 11:22

69 302 1
Surgical Atlas of pediatric otolaryngology - part 3 pps

Surgical Atlas of pediatric otolaryngology - part 3 pps

... Figure 7 33 The sural nerve, located adjacent to the saphenous vein in the lower part of leg 180 Surgical Atlas of Pediatric Otolaryngology • An appropriate number of 9-0 or 1 0-0 monofilament ... hidden by a bikini-style bathing suit (Figure 8 30 ) Figure 8 30 The lower abdomen skin graft site 208 Surgical Atlas of Pediatric Otolaryngology • The donor site is...

Ngày tải lên: 11/08/2014, 11:22

57 207 1
Surgical Atlas of pediatric otolaryngology - part 4 doc

Surgical Atlas of pediatric otolaryngology - part 4 doc

... right hemi-transfixion incision 266 Surgical Atlas of Pediatric Otolaryngology • On the concave side of the nasal septum, the mucoperichondrium is dissected back 4- 5 mm from the edge of the QC ... Figure 11– 14 The No 11 blade is utilized to complete the transcolumellar incision 2 74 Surgical Atlas of Pediatric Otolaryngology • Dissection will be limited because...

Ngày tải lên: 11/08/2014, 11:22

60 208 0
Surgical Atlas of pediatric otolaryngology - part 5 pps

Surgical Atlas of pediatric otolaryngology - part 5 pps

... according to the results of intraoperative cultures 364 Surgical Atlas of Pediatric Otolaryngology REFERENCES 10 11 12 13 14 15 16 17 18 19 20 Anon JB, Rontal M, Zinreich SJ Anatomy of the paranasal ... midline of the tongue for retraction 370 Surgical Atlas of Pediatric Otolaryngology • Wedge resection of the tongue (Figure 16–2) can be fashioned in several for...

Ngày tải lên: 11/08/2014, 11:22

62 265 0
Surgical Atlas of pediatric otolaryngology - part 6 ppt

Surgical Atlas of pediatric otolaryngology - part 6 ppt

... (Figure 20– 16) Figure 20–14 Elevation of cervical flaps with identification of important superficial anatomical structures 458 Surgical Atlas of Pediatric Otolaryngology • Intimate knowledge of the ... branch of the facial nerve as reviewed in detail in Chapter 23 460 Surgical Atlas of Pediatric Otolaryngology • During removal of the level lymph nodes within...

Ngày tải lên: 11/08/2014, 11:22

60 290 0
Surgical Atlas of pediatric otolaryngology - part 7 pdf

Surgical Atlas of pediatric otolaryngology - part 7 pdf

... Endoscopy of the Aerodigestive Tract Figure 25–14 Gum and teeth protection using a tooth guard and suspension of the instrument Figure 25–15 Insertion of a bronchoscope 573 574 Surgical Atlas of Pediatric ... outside of the parotid gland proper (see Figure 23–4) 522 Surgical Atlas of Pediatric Otolaryngology • A plane of cleavage through the parotid gland is deve...

Ngày tải lên: 11/08/2014, 11:22

55 216 0
Surgical Atlas of pediatric otolaryngology - part 8 ppt

Surgical Atlas of pediatric otolaryngology - part 8 ppt

... (Figure 28 13E) Laryngotracheal Laser Surgery Figure 28 13 F, Scar tissue is excised, and serial procedures are repeated at 6- to 8- week intervals F 667 6 68 Surgical Atlas of Pediatric Otolaryngology ... the tip of the bronchoscope NEODYMIUM-YTTRIUM-ALUMINUM-GARNET LASER The neodymium-yttrium-aluminum-garnet (Nd:YAG) laser operates at a wavelength of 1064 nm in the near-...

Ngày tải lên: 11/08/2014, 11:22

55 217 0
Surgical Atlas of pediatric otolaryngology - part 9 potx

Surgical Atlas of pediatric otolaryngology - part 9 potx

... can often be repaired using opposing advancement flaps of the remaining brow (Figure 29 12) Figure 29 11 Stent of the superior lacrimal canaliculus into the nasal cavity 694 Surgical Atlas of Pediatric ... St Louis: Mosby; 199 5 p 443–80 A B C D 684 Surgical Atlas of Pediatric Otolaryngology ular or postauricular pedicled flap with staged take down, delayed by 3-6 we...

Ngày tải lên: 11/08/2014, 11:22

59 228 0
Surgical Atlas of pediatric otolaryngology - part 10 ppt

Surgical Atlas of pediatric otolaryngology - part 10 ppt

... care, 116 selection of procedure, 109 – 110 staging, 110 surgical planning, 110 111 canal wall–up vs canal wall–down mastoidectomy, 101 102 classification, 100 101 congenital, 103 108 832 Index anterosuperior ... anterosuperior middle ear, 106 , 106 108 , 107 , 108 intratympanic membrane, 104 , 104 , 105 postoperative care, 108 facial nerve complications, 140 follow-up visit...

Ngày tải lên: 11/08/2014, 11:22

61 244 0
Pediatric Infectious Diseases Revisited - part 3 doc

Pediatric Infectious Diseases Revisited - part 3 doc

... of inflammatory eye disease Percentage 1874 32 3 45 13. 6 1875 287 37 12.9 1876 36 7 29 9.1 1877 36 0 30 8 .3 1878 35 3 35 9.8 1879 38 9 36 8.2 1880 (until 31 May) 187 14 7.6 1880 (from June to December) ... Zahl der Augenerkrankungen Procentsatz 1874 32 3 45 13, 6 1875 287 37 12,9 1876 36 7 29 9,1 1877 36 0 30 8 ,3 1878 35 3 35 9,8 1879 38 9 36 8,2 1880 (bis 31 Mai) 187...

Ngày tải lên: 12/08/2014, 05:21

51 280 0
w