Mitochondrial proteomics of colorectal cancer cells study of the effects of butyrate and subcellular expression of mortalin
... death This supports the association of the protective effects of butyrate with its biochemical effects on the mitochondria of cancer cells viii In particular, one of the mitochondrial proteins ... Enrichment of mortalin isoforms and presence of additional isoforms in HCT 116 mitochondrial fraction, relative to whole cell lysate 82 3.12 Butyrate effects...
Ngày tải lên: 26/11/2015, 12:25
... Caco-2 cells (Figure 4A) CXC receptor-4 gene silencing abrogates migration of colorectal cancer cells To analyze if the chemotactic effect of CXCL12 on the migration of HT-29 and SW480 cells ... rate of colorectal cancer cells after CXCR4 blockage by mRNA silencing and inhibition antibodies CXCR4 blockage by mRNA silencing or anti-CXCR4 antibodies might res...
Ngày tải lên: 20/06/2014, 03:20
... Adenovirus-mediated siRNA targeting Bcl-xL inhibits proliferation, reduces invasion and enhances radiosensitivity of human colorectal cancer cells Jinsong Yang1, 2, Ming Sun2, ... prognosis of colorectal cancer (CRC) patients The aim of this study was to investigate the association of Bcl-xL expression with invasion and radiosensitivity of huma...
Ngày tải lên: 09/08/2014, 02:21
Proteome analyses of butyrate treated HCT 116 colorectal cancer cells
... PROTEOME ANALYSES OF BUTYRATE- TREATED HCT- 116 COLORECTAL CANCER CELLS TAN HWEE TONG B.Sc (Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOCHEMISTRY ... maturation of butyrate- treated colorectal cancer cells Firstly, we performed 2-dimensional difference gel electrophoresis (2-D DIGE) of 24h butyrate- treated HC...
Ngày tải lên: 11/09/2015, 09:11
Báo cáo khoa học: MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells potx
... results obtained indicated that mature miR-143 enhanced sensitivity to 5-FU Indeed, cell viability was reduced and cell death was increased in HCT116- OV3 compared to parental and HCT116- EM1 cells, ... growth and ⁄ or escape from apoptosis In addition, miR-143 expression has been shown to increase after a-mangostin exposure in human colon cancer DLD-1 cells, res...
Ngày tải lên: 07/03/2014, 00:20
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, ... to the task: Interference effects of functional tasks on walking in Parkinson s disease and the roles of cognition, depression, fatigue, and balance Archives o...
Ngày tải lên: 28/03/2014, 20:20
Báo cáo sinh học: "A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" ppt
... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... gene, KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" doc
... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... gene, KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal...
Ngày tải lên: 20/06/2014, 03:20
the study enhancing the effects of english teaching by classroom eye contact at dong thap university
... investigate the reality of the use of classroom eye contact in English teaching Scope of the study The scope of the study is about enhancing the effects of English teaching by using eye contact at Dong ... at Dong Thap University Aims of the study The study aims to: - investigate what is the reality of using eye con...
Ngày tải lên: 05/07/2014, 08:03
báo cáo khoa học: " Pilot study evaluating the effects of an intervention to enhance culturally appropriate hypertension education among healthcare providers in a primary care setting" pdf
... this article as: Beune et al., Pilot study evaluating the effects of an intervention to enhance culturally appropriate hypertension education among healthcare providers in a primary care setting ... Please explain Finance Are there any issues related to your financial situation that make it difficult for you to manage hypertension? Please explain...
Ngày tải lên: 10/08/2014, 10:22
A study on the effects of using pictures to present vocabulary to efl adult learners at elementary level
Ngày tải lên: 28/08/2014, 04:53
A study on the effects of pre-listening activities on the listening performance of non-major 10th grade students at Nguyen Gia Thieu High school, Hanoi
... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES NGUYỄN DIỆU HUYỀN A STUDY ON THE EFFECTS OF PRE - LISTENING ACTIVITIES ON THE ... Data analysis of the questionnaire results 16 17 17 18 18 18 3.1.1 Data analysis of the teachers’ questionnaire 3.1.1.1 Teachers’ attitudes towards pre -listeni...
Ngày tải lên: 19/03/2015, 10:37
A STUDY ON THE EFFECTS OF PRE-LISTENING ACTIVITIES ON LISTENING COMPREHENSION TASKS IN THE TRAINING PROGRAM TO NON-ENGLISH MAJOR STUDENTS OF GRADE 10 AT BAC NINH GIFTED HIGH SCHOOL
... ABSTRACT The present study attempted to find out the effects of pre -listening activities on listening comprehension tasks in the training program to non-English major students of grade 10 at Bac Ninh ... my thesis: A Study on The Effects of Pre -Listening Activities on Listening Comprehension Tasks in The Train...
Ngày tải lên: 15/07/2015, 13:01