Glutathione s transferase pi expression in invasive ductal breast carcinoma

Glutathione s transferase pi expression in invasive ductal breast carcinoma

Glutathione s transferase pi expression in invasive ductal breast carcinoma

... Resisting intrinsic pressures for apoptosis 23 1.6.2 Resisting extrinsic pressures for apoptosis 25 1.6.3 Chemotherapy resistance 27 1.7 Glutathione S- transferase pi (GST -pi) 30 1.8 Scope of study ... analysis 49 2.10 Statistical analysis 50 RESULTS 51 3.1 Glutathione S- transferase pi (GST -pi) expression 52 3.2 Total glutathione S- transferase (GST) activity 55 v 3.3...

Ngày tải lên: 16/09/2015, 17:14

213 330 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelat...

Ngày tải lên: 31/03/2014, 15:20

10 432 0
Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc

Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc

... articular chondrocytes and as the main precursor for the synthesis of ECM glycosaminoglycans in cartilage [35,36] The inhibition of proteoglycan synthesis in OA chondrocytes by HNE (data not shown) ... goal of clarifying this role, we documented the ability of HNE to modulate markers of apoptosis, redox status, and energy metabolism of chondrocytes Then, we investiga...

Ngày tải lên: 09/08/2014, 13:21

11 395 0
Báo cáo y học: " Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan" ppt

Báo cáo y học: " Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan" ppt

... Pu YS, Su CT, Huang YK, Chen YT, Hsueh YM: Urinary 8-hydroxydeoxyguanosine and urothelial carcinoma risk in low arsenic exposure area Toxicol Appl Pharmacol 2008, 226:14-21 19 Huang YL, Hsueh YM, ... Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Ta...

Ngày tải lên: 10/08/2014, 05:21

11 640 0
Báo cáo y học: " Glutathione S-transferase omega in the lung and sputum supernatants of COPD patients" potx

Báo cáo y học: " Glutathione S-transferase omega in the lung and sputum supernatants of COPD patients" potx

... immunohistochemistry the alveolar epithelium was always positive in stage IV COPD The intensities of GSTO1-1 in various lung cells in healthy and diseased lung including all stages of COPD are shown in Figure ... COPD) were receiving inhaled corticosteroid therapy None of the subjects had received N-acetylcysteine treatment Sputum was induced by inhalation of...

Ngày tải lên: 12/08/2014, 15:20

9 426 0
Báo cáo y học: "Anticitrullinated protein antibody (ACPA) in rheumatoid arthritis: influence of an interaction between HLA-DRB1 shared epitope and a deletion polymorphism in glutathione s-transferase in a cross-sectional study" ppt

Báo cáo y học: "Anticitrullinated protein antibody (ACPA) in rheumatoid arthritis: influence of an interaction between HLA-DRB1 shared epitope and a deletion polymorphism in glutathione s-transferase in a cross-sectional study" ppt

... SONORA) were excluded from further analyses, leaving available data from 703 VARA individuals and 610 SONORA participants for analysis Determination of HLA-DRB1 genotypes In VARA, HLA genotyping ... (VA Merit) and the American College of Rheumatology Research and Education Foundation The authors thank Debra Bergman and Bart Hamilton for their assistance in this work and th...

Ngày tải lên: 12/08/2014, 15:22

10 338 0
Báo cáo y học: " Glutathione S-transferase genotypes modify lung function decline in the general population: SAPALDIA cohort study" pps

Báo cáo y học: " Glutathione S-transferase genotypes modify lung function decline in the general population: SAPALDIA cohort study" pps

... excess decline in lung function [ml/yr] compared to the decline in the reference group and coefficient values above zero correspond to a less steep decline in lung function compared of the reference ... several lines of evidence point to the involvement of the supergene family of glutathione Stransferase (GST) in respiratory disease etiology, including that o...

Ngày tải lên: 12/08/2014, 16:20

17 253 0
Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx

Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx

... blue, hematine, and p-chloranil were obtained from ICN; hydroxyethyl disulfide (HEDS) and vinylene trithiocarbonate was obtained from Aldrich EST identification and cDNA isolation The S mansoni EST ... (lane 4) electroblotted and immunodetected by a-SmGSTO serum (B) RT-PCR analysis of different S mansoni stages Reverse-transcribed RNA from miracidia (lane 1), sporocysts (lane...

Ngày tải lên: 21/02/2014, 01:21

10 638 0
ẢNH HƯỞNG CỦA THUỐC TRỪ SÂU HOẠT CHẤT QUINALPHOS ĐẾN HOẠT TÍNH MEN CHOLINESTERASE VÀ GLUTATHIONE-S-TRANSFERASE CỦA CÁ CHÉP (CYPRINUS CARPIO) ppt

ẢNH HƯỞNG CỦA THUỐC TRỪ SÂU HOẠT CHẤT QUINALPHOS ĐẾN HOẠT TÍNH MEN CHOLINESTERASE VÀ GLUTATHIONE-S-TRANSFERASE CỦA CÁ CHÉP (CYPRINUS CARPIO) ppt

... sâu quinalphos không ảnh hưởng nhiều đến hoạt tính men GST cá chép (Cyprinus carpio) KẾT LUẬN VÀ ĐỀ XUẤT 5.1 Kết luận Giá trị LC50-96 thuốc trừ sâu hoạt chất quinalphos cá chép 0,76 mg/L Quinalphos ... gây ảnh hưởng đến hoạt tính men cá chép Theo Đỗ Thị Thanh Hương (1997) nghiên cứu ảnh hưởng nồng độ thuốc Basudin (hoạt chất...

Ngày tải lên: 11/03/2014, 05:21

12 619 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

... of at least six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes The ... cockroach, Blattella germanica (L.) Pestic Biochem Physiol 61, 53–62 Yu SJ & Huang SW (2000) Purification and characterization of glutathione S-transferases fro...

Ngày tải lên: 23/03/2014, 09:21

11 426 0
Báo cáo khoa học: Transfection with 4-hydroxynonenal-metabolizing glutathione S-transferase isozymes leads to phenotypic transformation and immortalization of adherent cells pdf

Báo cáo khoa học: Transfection with 4-hydroxynonenal-metabolizing glutathione S-transferase isozymes leads to phenotypic transformation and immortalization of adherent cells pdf

... metabolism of 4-HNE and thereby lowering of the intracellular concentrations of 4-HNE leads to the observed phenotypic transformation and immortalization of WT-HLE B-3 cells Microinjection of the ... CCL-75 cells ranged from 40% to 70% To determine the effect of wildtype and mutant forms of GST on injected cells, all surviving HLE B-3 and CCL-75 cells...

Ngày tải lên: 30/03/2014, 13:20

12 356 0
Báo cáo khoa học: Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx

Báo cáo khoa học: Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx

... conditions as given in Fig Ó FEBS 2002 Purification of R decussatus GST isoforms (Eur J Biochem 269) 4363 Table Biochemical characteristics of R decussatus GST isoforms Results are expressed as means ... antisera specific of mammalian pi-class GST Studies of aquatic species such as salmonids [26], Bufo bufo [27] and M edulis [28], showed that their GSTs belong to the pi c...

Ngày tải lên: 31/03/2014, 09:20

8 338 0
Báo cáo khoa học: "Genomic alterations of primary tumor and blood in invasive ductal carcinoma of breast" pdf

Báo cáo khoa học: "Genomic alterations of primary tumor and blood in invasive ductal carcinoma of breast" pdf

... gain were detected in at least 30% of both primary tumors and blood (Table 5) Among these, seven regions of copy number gain were found in more than 50% of both primary tumors and blood A gain ... amplified in 90% of the presently studied tumors We identified 46 regions of gain present in more than 30% of the primary tumor samples and 70 regions of gain...

Ngày tải lên: 09/08/2014, 03:21

11 434 0
C erBB2 over expression in invasive breast carcinoma

C erBB2 over expression in invasive breast carcinoma

... immunostaining of invasive ductal breast carcinoma 2+ positive staining 54 C- erbB2 immunostaining of invasive ductal breast carcinoma 3+ positive staining 55 Ductal Carcinoma in situ component of invasive ... cell Myoepithelioma Carcinoid Mesenchymal origin Sarcomas Miscellaneous origin Hematopoietic Metastatic carcinoma 1.2.2.1 Ductal carcinoma in situ (DCIS) Duct...

Ngày tải lên: 02/10/2015, 12:56

168 409 0
Báo cáo hóa học: " Prognostic significance of Oct4 and Sox2 expression in hypopharyngeal squamous cell carcinoma''''" doc

Báo cáo hóa học: " Prognostic significance of Oct4 and Sox2 expression in hypopharyngeal squamous cell carcinoma''''" doc

... localized in the nucleus of tumor cells (A) High Oct4 expression in tumor cells, (B) low Oct4 expression in tumor cells, (C) high Sox2 expression in tumor cells, and (D) low Sox2 expression in tumor cells ... and Sox2 expression in hypopharyngeal squamous cell carcinoma Brown grains represent a positive signal (3, 3-diaminobenzidine staining) The po...

Ngày tải lên: 18/06/2014, 16:20

7 494 0
w