Ohanin a novel protein from king cobra (ophiophagus hannah) venom

Ohanin   a novel protein from king cobra (ophiophagus hannah) venom 2

Ohanin a novel protein from king cobra (ophiophagus hannah) venom 2

... fragments can then associate to form an enzymatically active protein to cleave the chromogenic substrates This process is called as α-complementation Properly expressed β-galactosidase protein (after ... chemicals, adjust to pH 7.8 using glacial acetic acid and autoclave Dilute to 1X before use SOB medium (for preparation of competent cells) Tryptone Yeast extract NaCl KCl MgCl2.6H2O MgSO...

Ngày tải lên: 16/09/2015, 15:55

7 156 0
Ohanin   a novel protein from king cobra (ophiophagus hannah) venom

Ohanin a novel protein from king cobra (ophiophagus hannah) venom

... S A N P E F L G * aagacatccagtctctgaagggacccccaccccccatccatggacattactggacatccc ctgcaatcatccagggccccaccggcgggacccccaacggtcaacaccccttttcaatat gtcccttcaaataaactcactagactgg SRTX -a1 SRTX-c SRTX-b SRTX-c ... N V gagccactttgctcctgtaaagacatgacggataaagagtgcctcaatttctgccatcag E P L C S C K D M T D K E C L N F C H Q gacgtcatctggaaaaatgcggacaccagcgccaatccagagttcctaggctagctagga D V I W K N A D T S A...

Ngày tải lên: 16/09/2015, 15:55

180 230 0
The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system

The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system

... Animalia kingdom, Chordata phylum, Vertebrata subphylum, the Reptilia class and Squamata order (Evans, 2003) Venomous Snakes There are many different and diverse species of animals across all phyla ... Cobras, coral snakes, kraits, mambas, sea snakes, sea kraits and Australian elapids Viperidae (viperids) True vipers and pit vipers, including rattlesnakes Table Snakes that known to cause...

Ngày tải lên: 16/10/2015, 15:35

79 278 0
A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

... aaactcaaaa gtttagggtt tttaaaacac cctttaaaaa cgatgcccta tattttagag ggcgggagca tagaaagcga tggggctggg agcgttttaa ccaacaccca atgcctgtta gaaaaaaatc gtaaccccca tttgaatcaa aatggaatag aaaacatgct taaaaaggaa ... ttaggggcta aacaggtgct ttggtattct tatggctatc tcaaaggcga tgataccgat agccataccg acacgctcgc tcgtttttta gataaagaca ccattgttta tagcacatgc gaggatgaaa acgatgagca ctacacagcc ttaaaaaaaa tgcaagaaga attaaa...

Ngày tải lên: 26/09/2015, 09:35

103 216 0
A novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

A novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

... Lalitha Rajagopalan, my brothers Mr Prasanna and Mr Vasanth and my cousins Ms Aarthi Ravichandran and Ms Madhulika Ravichandran Nandhakishore Rajagopalan January, 2008 v TABLE OF CONTENTS Page ... and highly neurotoxic 1.1.2 Ophiophagus hannah This thesis deals with proteins isolated from the venom of Ophiophagus hannah (King cobra) This snake belongs to the family...

Ngày tải lên: 11/09/2015, 14:20

246 357 0
Beta cardiotoxin  a novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

Beta cardiotoxin a novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

... Lalitha Rajagopalan, my brothers Mr Prasanna and Mr Vasanth and my cousins Ms Aarthi Ravichandran and Ms Madhulika Ravichandran Nandhakishore Rajagopalan January, 2008 v TABLE OF CONTENTS Page ... and highly neurotoxic 1.1.2 Ophiophagus hannah This thesis deals with proteins isolated from the venom of Ophiophagus hannah (King cobra) This snake belongs to the family...

Ngày tải lên: 12/09/2015, 08:19

246 321 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

... tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex aeolicus; Tt, Thermoanaerobacter tengcongensis ... presence of unlabeled ATP, indicating that ATP and the analog 8-azido-ATP recognize the same binding site The ATPase activity of PfPDO was demonstrated The hydrolysis of ATP...

Ngày tải lên: 16/03/2014, 16:20

12 506 0
Báo cáo y học: " A novel protein-coding ORF72.2 gene was identified from Marek’s disease virus strain CVI988" pot

Báo cáo y học: " A novel protein-coding ORF72.2 gene was identified from Marek’s disease virus strain CVI988" pot

... Nakamura K, Tsukamoto K, Hihara H: Isolation of Marek’s disease virus from Japanese quail with lymphoproliferative disease Avian Pathol 1990, 19:119-129 10 Gunasekera RS, Damodaran H, Rajakarunanayake ... Taxonomy of Viruses Academic Press; 2005 Witter RL: Protection by attenuated and polyvalent vaccines against highly virulent strains of Marek’s disease virus Avian Pathol 198...

Ngày tải lên: 11/08/2014, 21:21

5 287 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCC...

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx

Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx

... S-300 Novel trehalase from Mycobacterium smegmatis Molecular mass standards included thyroglobulin (669 kDa), b-amylase (200 kDa), alcohol dehydrogenase (150 kDa) and BSA (66 kDa) SDS ⁄ PAGE was ... optima, from acidic trehalases with optima at 4.0–5.6 to neutral trehaA Novel trehalase from Mycobacterium smegmatis lases with pH optima of about 7, like the mycobacterial e...

Ngày tải lên: 16/03/2014, 11:20

14 271 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

... [8], the CS -a/ b motif [2] Alignment of Fig 2, using the CLUSTAL X program, shows a clear cut separation of all the b Na-ScTxs from all the a Na-ScTxs The a Na-ScTxs have identities of the order of ... Discussion NMR solution structure of Cn12 Figures 4, and summarize the most important data obtained from the NMR analysis of pure Cn12 It was poss...

Ngày tải lên: 23/03/2014, 12:20

13 435 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... 140), A9 0 is the absorption with the 90 polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands SL is for the lipid chains, derived from ... Similar aggregates appeared only very faintly in the absence of lipids (Fig 4A) The rather long lag phase preceding fast hemolysis (Fig 1A) may also indicate that...

Ngày tải lên: 23/03/2014, 21:20

12 492 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... in Fig Within the nucleus, the protein again seemed to be localized to compartments in the interchromatin space (Fig 7) To further confirm the localization of ISP36, an inter4329 Interchromatin ... Peptidyl-prolyl-cis-trans isomerase B precursor Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lami...

Ngày tải lên: 30/03/2014, 20:20

12 400 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20

9 490 0
Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra)...

Ngày tải lên: 10/09/2015, 08:37

308 442 0
w