Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplificatio...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
Báo cáo sinh học: " Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis" docx

Báo cáo sinh học: " Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis" docx

... HALT -C trial and 12 HCV-HIV co-infected patients receiving or not receiving HAART Results Clinical characteristics of the HALT -C and HCV-HIV coinfected patients are depicted in Tables and For ... performed according to manufacturer's specifications http://www.virologyj.com/content/2/1/41 Clonal Frequency Analysis (CFA) For each cloned HVR1 PCR product, 20 colonies were picked direct...

Ngày tải lên: 19/06/2014, 08:20

11 453 0
Sexually transmitted infections and other reproductive tract infections in rural vietnam

Sexually transmitted infections and other reproductive tract infections in rural vietnam

... Mogren I, Stålsby Lundborg C Perceptions and attitudes in relation to reproductive tract infections including sexually transmitted infections in rural Vietnam: A qualitative study Health Policy ... (STI) and other reproductive tract infections (RTI) constitute a huge health and economic burden in low-income countries The infections may result in severe s...

Ngày tải lên: 27/07/2014, 20:15

91 1,1K 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... Univariate analysis of categorical factors associated with HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya, Ukraine (Unadjusted odds ratios with 95% confidence ... that can establish a first link between the IDU and Table 3: Univariate analysis of continuous factors associated with HIV and hepatitis C virus (HCV) infectio...

Ngày tải lên: 11/08/2014, 18:20

9 331 0
Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

... square brackets that define the HEV subtypes Each branch is labeled with the host of the HEV isolate, GenBank accession number and the year the strain was isolated Reference sequences are labeled ... excluded Genotype HEV strains were geographically limited to Shanghai and neighboring provinces, and seven sequences were classified into subtype 3b No human genotype HEV sequences were among t...

Ngày tải lên: 11/08/2014, 21:22

10 364 0
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

... (40-50 years) people Third highest active HCV infection was 2.13% observed in age group 31-40 years People including in age group 21-30 years revealed 1.82% active HCV infection High prevalence of ... have no active HCV infection The absence of HCV infection in this age group may be due to their least exposure to some of the high risk factors causing HCV such as expo...

Ngày tải lên: 12/08/2014, 02:20

5 268 0
Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

... genotypespecific PCR assay Figure-2 shows a typical agarose gel showing different HCV genotype-specific bands (HCV1a & HCV-3a) Pattern of HCV genotypes in the study population The distribution of HCV genotypes ... Mass vaccination in the recent past in which un-sterilized syringes were used might have enhanced the infection rate in this country [23] This type of practice is...

Ngày tải lên: 12/08/2014, 04:20

7 368 0
Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

... genotypes/subtypes, and the factors associated with HCV infection in long-distance truck drivers in Brazil A cross-sectional study was carried out in a population of long-distance truck drivers in ... 81 truck drivers who reported illicit drug use, the majority had used non-injecting drugs, including the anti-HCV-positive individuals The risk of HCV infection associated...

Ngày tải lên: 12/08/2014, 04:20

6 381 0
Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

... 5’TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’) In the third step, the recombinant 531 bp DNA fragment (F3) containing last amino acids of EGFP-N1 and 177 amino acids of NS 5A (nt 75478077) was amplified ... doi:10.1186/1743-422X-7-36 Cite this article as: Hazari et al.: Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells...

Ngày tải lên: 12/08/2014, 04:21

16 391 0
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

... Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl aliquots of HCVcc stock (2.5 × 104 FFU/ml) were placed in 48-well ... tested concentration, is highly effective in eliminating the infectivity of both extracellular and intracellular HCVcc particles Discussion In this study, a detailed analysis was co...

Ngày tải lên: 12/08/2014, 04:21

12 411 0
Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32( 10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: Alterations of glucose ... The prevalence rate of 11% recorded in this study is in agreement with the work of [5] who also recorded 11.5% against 2. 5% when prevalence of HCV infection was checked among...

Ngày tải lên: 12/08/2014, 04:21

5 463 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... http://www.comparative-hepatology.com/content/5/1/4 body), splenomegaly, ascitis, edema, cirrhosis, grade and stage of liver biopsy, and child score and status (inactive, chronic, cirrhotic and active) of ... molecular epidemiology of HCV by the introduction of subtype 1a and 3a from USA and Southeast Asia into their young drug addicts [44] Our results are in accorda...

Ngày tải lên: 13/08/2014, 13:20

6 337 0
Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

... factor for < /b> both disease transmission Screening < /b> test for < /b> HBsAg and anti-HCV in blood < /b> donors is in place in South East Asia including Cambodia and Vietnam whereas anti-HBc screening < /b> in blood < /b> donors ... Anti-HBs Antibodies to Hepatitis < /b> B surface antigen Anti-HCV Antibodies to Hepatitis < /b> C BCP Basal Core Promoter cccDNA...

Ngày tải lên: 03/03/2015, 21:05

64 465 0
w