Báo cáo y học: "Accuracy of hyaluronic acid level for predicting liver fibrosis stages in patients with hepatitis C virus" pptx

... affect fetal growth and placental function. Key words: Radical trachelectomy, uterine cervical cancer, 3-D CT scanning Introduction Uterine cervical cancer is one of the most com- mon cancers ... B: Ascending branch of left uterine artery. C: Descending branch of right uterine artery. D: Descending branch of left uterine artery. Identification of each vessel was also made by a...

Ngày tải lên: 25/10/2012, 11:48

... sites. Because MRMC is a tertiary cancer center, actigraphy data were recorded in the in- patient setting prior to and often during the administration of the first cycle of che- motherapy. Actigraphy ... first cycle of therapy, to ach ieve a minimum of 48 hours of high quality continuous activity data. The timing and conditions of actigraphy measure- ment were necessarily diffe...

Ngày tải lên: 10/08/2014, 09:20

... University of Medical Sciences, Iran. 2 Tehran Psychiatry Institute, Tehran University of Medical Sciences, Iran. Authors’ contributions All authors were involved in the conceptualisation of the study ... problems, including more depres- sion, than the non-referral patients with diabetes. The main objectives of ou r study were to det ermine the accuracy of PHQ-9 and CES-D ques...

Ngày tải lên: 11/08/2014, 15:22

... 5′-gatccagctcatcggaactgaca att- caagagattgtcagttccgatgagctttttttggaaa-3′; 5AtPRE1317 5′- agcttttccaaaaaaagctcatcggaactgacaatctcttgaattgtcagttcc- gatgagctg-3′; PRE 1329 5′-gatccgctgacaattctgtcgtcctttcaa- gagaaggacgacagaattgtcagttttttggaaa-3′ ... (forward: HBV PRE_1485F 5′-tctagagc- tagctcgtccccttctccgtct-3′, reverse: HBV PRE_1584R 5′- gccgg cctcgaggtgcacacggaccggcagat-3′). The Amplification wa...

Ngày tải lên: 12/08/2014, 01:21

... at baseline Subject blind Therapist blind Assessor blind <15% dropout ITT analysis Between- group analysis Point measures Score on PEDro scale Rannou, et al. [31] Yes Yes Yes No No Yes Yes Yes Yes Yes 8 Basford, et al. [22] Yes No Yes Yes No Yes Yes Yes Yes Yes 8 Brosseau, et al. [24] Yes Yes Yes Yes Yes Yes Yes ... both non-pharmacological and non-surgical treatments used by therapists i...

Ngày tải lên: 12/08/2014, 15:22

... Evidence-based guidelines for weaning and dis- continuing ventilatory support: a collective task force facili- tated by the American College of Chest Physicians; the American Association for Respiratory ... rising leucocyte count; and character- istic chest radiograph findings. The duration of ventilation was calculated as follows: (day of extubation + 1) - (day of intuba- tion)....

Ngày tải lên: 12/08/2014, 20:21

... insulin with such absolutely insulin- deficient patients. Consent Written informed consent was obtained from the patients for publication of this case report and any accompanying images. A copy of ... levels in patients who absolutely lack the capacity for endogenous insulin secretion. Th e improvement seen in glycemic control could not be due to enhanced endogenous insuli...

Ngày tải lên: 11/08/2014, 00:23

... amplification cycles consisted of 95 C for five seconds as first steps (one cycle), 95 C for five seconds and 60 C for 30 seconds for CTGF as second steps (45 cycles), 95 C for five seconds and 60 C ... that CTGF adenovirus vector transfection into knee joints of mice induces linier overexpression of CTGF in the synovium and results in cartilage damages with increas...

Ngày tải lên: 12/08/2014, 11:22

... polymerase chain reaction The primers were designed by BIOSUNE (Shanghai, China): IFN-l1 forward primer 5’-TAT CCA GCC TCA GCC CAC AG-3’, reverse primer 5’-CTC AGA C AC AGG TTC CCA TCG-3’ ; b-actin forward ... 5’ - CAC TCT TCC AGC CTT CCT TCC-3’, reverse primer 5’ -AGG TCT TTG CGG ATG TCC AC-3’ . Real-time polymerase chain reaction (PCR) amplification reactions were prepared with the SYBR...

Ngày tải lên: 12/08/2014, 15:23

... diagnosis of CFA was based on the following: presence of diffuse mid-, late or pan-inspiratory crackles, with or without clubbing; the absence of clinical, radiological or laboratory evidence of any ... of autoreactivity over a period of 3 years (Fig. 2). Molecular cloning of antigens associated with cryptogenic fibrosing alveolitis A λ expression library with a complexity...

Ngày tải lên: 12/08/2014, 18:20