Báo cáo y học: "Tracheostomy – a multiprofessional handbook" docx

Báo cáo y học: "Tracheostomy – a multiprofessional handbook" docx

Báo cáo y học: "Tracheostomy – a multiprofessional handbook" docx

... has advantages and disadvantages that have to be addressed individually when a specific tracheostomy technique is chosen for the individual patient. This book is characterized by a standard and ... and effective chapter format that first sets out the basics of physiology and anatomy, then key aspects of technical and clinical management, and finally a brief summary of the main topics di...

Ngày tải lên: 12/08/2014, 20:20

2 168 0
Báo cáo y học: " Tracheostomy patients on the ward: multiple benefits from a multidisciplinary team" pps

Báo cáo y học: " Tracheostomy patients on the ward: multiple benefits from a multidisciplinary team" pps

... such as hydration, humidifi cation of airway, and suctioning of secretions 9. Factors leading to inadvertent decannulation (such as underlying mental status) and the best way of securing tracheostomy ... care when compared with historical controls. Although a large prospective randomized trial is desirable before MDT is recommended, many institutions may have already formed a team...

Ngày tải lên: 13/08/2014, 20:21

2 241 0
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. M...

Ngày tải lên: 03/11/2012, 11:52

5 724 0
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

... 15, 43 1–4 40. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharmacol. 86, 20 3–2 14. 56. Miyazaki,M.,Wada,T.,Shiota,N.&Takai,S.(1999)Effectofan angiotensin ... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3...

Ngày tải lên: 08/03/2014, 09:20

10 382 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... forward primer D1 1–1 3 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D4...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... AMY2/acarbose (Fig. 1A) . Superpositioning of AMY2 and TAA guided by the catalytic acids was excellent for Tyr51 AMY2 and Tyr82 TAA (Fig. 1A) and mutation in Saccharomycopsis fibuligera...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

... cells transformed by X-ray, UV-C, and 3-methylcholanthrene, detected by a DNA fingerprint assay. Cancer Res. 52, 578 8–5 793. 12. Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K. & Nagao, ... cytoplasmic extraction. The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig. Lanes 1 and 4, whole cell lysate; lanes 2 and 5, cytoplasmic fraction;...

Ngày tải lên: 31/03/2014, 23:20

7 305 0
Báo cáo y học: "Fluoxetine: a review on evidence based medicine" pdf

Báo cáo y học: "Fluoxetine: a review on evidence based medicine" pdf

... disorder: A meta-analysis. Acta Psychiatrica Scandinavica 2002, 106(3):163-167. 11. Khan A, Leventhal RM, Khan S, Brown WA: Suicide risk in patients with anxiety disorders: A meta-analysis of the FDA ... Barraco and Pietro Donda Address: Medical Dept. Eli Lilly Italia S.p .A. via Gramsci, 731, Sesto fiorentino (Florence), Italy Email: Andrea Rossi* - rossi_andrea _a@ lilly.com; Alessandr...

Ngày tải lên: 08/08/2014, 20:23

8 608 0
Báo cáo y học: "Urokinase, a constitutive component of the inflamed synovial fluid, induces arthritis" pps

Báo cáo y học: "Urokinase, a constitutive component of the inflamed synovial fluid, induces arthritis" pps

... HGF-mediated release of inflammatory cytokines (IL-6 and granulocyte–macrophage colony-stimulating factor) by human monocytes [34]. The uPA-induced arthritis may be mediated, besides its proteolytic ... Synovial hyper- trophy was defined as a synovial membrane thickness of more than two cell layers. The intensity of inflammatory cell infiltration of the synovia (arthritis index) was graded...

Ngày tải lên: 09/08/2014, 01:21

9 371 0
Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps

Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps

... http://arthritis-research.com/content/5/6/R310 R315 20. Fujikawa Y, Sabokbar A, Neale S, Athanasou NA: Human osteo- clast formation and bone resorption by monocytes and syn- ovial macrophages in rheumatoid arthritis. Ann Rheum Dis 1996, ... NaCl, pH 7.5, and sequentially treated with affinity-purified rabbit antisera raised against recombinant mactinin, followed by second antibody conjugate...

Ngày tải lên: 09/08/2014, 01:23

7 388 0
Từ khóa:
w