báo cáo khoa học: " Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes" pptx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

... 2004 Regulation of iPLA 2 c biosynthesis (Eur. J. Biochem. 271) 4713 Complex transcriptional and translational regulation of iPLA 2 c resulting in multiple gene products containing dual competing ... heat- ing a 4-l M mixture of primers to 95 °C for 3 min followed by cooling to 22 °C prior to cloning into the Xho1/Sal1 sites of vector pEGFP-N3. Integri...

Ngày tải lên: 19/02/2014, 16:20

16 438 0
Báo cáo khoa học: Comprehensive interaction of dicalcin with annexins in frog olfactory and respiratory cilia pdf

Báo cáo khoa học: Comprehensive interaction of dicalcin with annexins in frog olfactory and respiratory cilia pdf

... for the interaction of frog annexin A1 and annexin A2 with dicalcin. Consistently, we observed that the 35 kDa forms of annexin A1 and annexin A2 found in the fraction of the binding proteins of dicalcin (Fig. ... of dicalcin with annexin A1, annexin A2 or annexin A5 in frog olfactory epithelium. (A–I) Immunofluorescence double- staining of dicalcin and...

Ngày tải lên: 07/03/2014, 05:20

14 477 0
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf

Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf

... FEBS REVIEW ARTICLE Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme Christos Chinopoulos and Vera Adam-Vizi Department of Medical Biochemistry, ... chan- nel with a large conductance provided by proteins resi- ding in both the inner and outer mitochondrial membrane, that is activated by mitochondrial Ca 2...

Ngày tải lên: 07/03/2014, 12:20

18 549 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

... et al. Cuticular proteins in horseshoe crabs FEBS Journal 272 (2005) 47744786 ê 2005 FEBS 4785 and DE29 is involved in chitin binding. In insects, cuticular proteins containing cysteine residues ... microorganisms [28,29]. In order to identify novel cuticular chitin-bind- ing proteins and cuticular proteins involved in innate immunity, we undertook an extensiv...

Ngày tải lên: 07/03/2014, 21:20

13 584 0
Báo cáo khoa học: Insulin like growth factor-1-induced phosphorylation and altered distribution of tuberous sclerosis complex (TSC)1⁄TSC2 in C2C12 myotubes pptx

Báo cáo khoa học: Insulin like growth factor-1-induced phosphorylation and altered distribution of tuberous sclerosis complex (TSC)1⁄TSC2 in C2C12 myotubes pptx

... 2010 FEBS Insulin like growth factor-1-induced phosphorylation and altered distribution of tuberous sclerosis complex (TSC)1 ⁄ TSC2 in C2C12 myotubes Mitsunori Miyazaki, John J. McCarthy and Karyn ... control group (P < 0.05). Phosphorylation of Akt and S6K1 was induced within 10 min, and was maintained for at least 60 min. Altered distributions...

Ngày tải lên: 15/03/2014, 11:20

12 411 0
Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc

Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc

... directly interacting with the sub- strate proteins and helping to transfer ubiquitin to them. Therefore, to determine whether NCT is the substrate of Synoviolin, we determined whether Syno- violin interacts ... by the overexpression of Synoviolin, although the nicastrin level was decreased. Thus, Synoviolin-mediated ubiquitination is involved in the degradation...

Ngày tải lên: 23/03/2014, 04:20

9 562 0
Báo cáo khoa học: Functional interplay between viral and cellular SR proteins in control of post-transcriptional gene regulation pptx

Báo cáo khoa học: Functional interplay between viral and cellular SR proteins in control of post-transcriptional gene regulation pptx

... environments. The interplay between viral and cellular SR proteins certainly has a substantial effect on post- Table 1. Functional interplay between viral proteins and cellular SR proteins as well as SR kinases ... proteins SR P A B C Fig. 2. Viral and host gene expression is modulated through the interplay between viral proteins and cell...

Ngày tải lên: 23/03/2014, 06:20

10 317 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

... the absence of CIII, CII is rapidly degraded by the ATP- dependent host metalloprotease HflB (FtsH). The molecular mechanism for CIII-mediated inhibition of the proteolysis of CII by HflB involves CIII HflB interaction ... mode of action for kCIII would be independent of the HflB substrate. In this study, we tested the ability of CIII to protect...

Ngày tải lên: 23/03/2014, 10:20

6 454 0
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

... 10C. Radioactivity in the trichloro- ATGACCATGATTACGAATTCCGAGCTCGGTACCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG CAGCACTGACCCTTTTG—5’ 32p EcoR1 Sac1 Kpn1 Sma1 Xma1 BamH1 Xba1 Sal1 HincII Pst1 Sph1 HindIII LacZ Acc1 MCS M13 ... TTCGAACGTACGGACGTCCA…5’ TTCGAACGTACGGACGTCCA…5’ TTCGAACGTACGGACGTCCA…5’ 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGG...

Ngày tải lên: 30/03/2014, 08:20

19 350 0
Báo cáo khoa học: "Gene expression profiling of human dermal fibroblasts exposed to bleomycin sulphate does not differentiate between radiation sensitive and control patients" pptx

Báo cáo khoa học: "Gene expression profiling of human dermal fibroblasts exposed to bleomycin sulphate does not differentiate between radiation sensitive and control patients" pptx

... 6:42 http://www.ro-journal.com/content/6/1/42 Page 2 of 6 SHOR T REPOR T Open Access Gene expression profiling of human dermal fibroblasts exposed to bleomycin sulphate does not differentiate between radiation sensitive and control patients Charlotte ... fibroblasts exposed to bleomycin sulphate does not differentiate between radiation...

Ngày tải lên: 09/08/2014, 09:20

6 355 0
Báo cáo y học: "Genomic transcriptional profiling identifies a candidate blood biomarker signature for the diagnosis of septicemic melioidosis" ppsx

Báo cáo y học: "Genomic transcriptional profiling identifies a candidate blood biomarker signature for the diagnosis of septicemic melioidosis" ppsx

... unsupervised analyses also revealed heterogeneity among the sepsis signature. Canonical pathway and gene network analysis of the 37 classifiersFigure 7 Canonical pathway and gene network analysis of the ... forward primer, 5'-gctggaaagctgagagagactt-3', and reverse primer, 5'-cctgat- gcagaccataaaagg-3'; HLA-DMA [GenBank:NM_006120.3 ] forward primer, 5'-agct...

Ngày tải lên: 09/08/2014, 20:20

22 395 0
báo cáo khoa học: " Transcript and metabolite analysis in Trincadeira cultivar reveals novel information regarding the dynamics of grape ripening" potx

báo cáo khoa học: " Transcript and metabolite analysis in Trincadeira cultivar reveals novel information regarding the dynamics of grape ripening" potx

... from linkage group 2 interacting with the second QTL from linkage group 14. F. one QTL from linkage group 6 interacting with the second QTL from linkage group 12. In each case, the peak of the ... position within a marker interval can be estimated by treating the position is fixed . Using a grid search, we can obtain the MLE of t he QTL posi- tion from the peak of the...

Ngày tải lên: 11/08/2014, 11:21

9 459 0
báo cáo khoa học: " Transcript and metabolite analysis in Trincadeira cultivar reveals novel information regarding the dynamics of grape ripening" ppsx

báo cáo khoa học: " Transcript and metabolite analysis in Trincadeira cultivar reveals novel information regarding the dynamics of grape ripening" ppsx

... 137-140. doi:10.1186/1471-2229-11-149 Cite this article as: Fortes et al.: Transcript and metabolite analysis in Trincadeira cultivar reveals novel information regarding the dynamics of grape ripening. BMC Plant Biology 2011 11:149. Submit ... RESEARCH ARTICLE Open Access Transcript and metabolite analysis in Trincadeira cultivar reveals novel...

Ngày tải lên: 11/08/2014, 11:21

35 339 0
báo cáo khoa học: " Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes" pptx

báo cáo khoa học: " Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes" pptx

... article Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes Yuanqing Jiang and Michael K Deyholos* Address: Department of Biological ... and many of the other NaCl -responsive TFs shown in Table 6 are potentially important regulators of the NaCl-stress response in Arabidopsis roots. An interest...

Ngày tải lên: 12/08/2014, 05:20

20 170 0
Báo cáo khoa học: " A long-term follow-up study investigating health-related quality of life and resource use in survivors of severe sepsis: comparison of recombinant human activated protein C with standard care" pot

Báo cáo khoa học: " A long-term follow-up study investigating health-related quality of life and resource use in survivors of severe sepsis: comparison of recombinant human activated protein C with standard care" pot

... (physical, social and emotional function) and reduced health-related quality of life (HRQoL) [6]. In a large randomized clinical trial, recombinant human acti- vated protein C (APC) therapy was shown ... sur- rogate decision maker. Contact information for both the patient and next of kin was obtained. To avoid an imbalance between APC and standard care patients...

Ngày tải lên: 13/08/2014, 10:20

11 376 0
w