báo cáo khoa học: " A full-length enriched cDNA library and expressed sequence tag analysis of the parasitic weed, Striga hermonthica" pot

báo cáo khoa học: " A full-length enriched cDNA library and expressed sequence tag analysis of the parasitic weed, Striga hermonthica" pot

báo cáo khoa học: " A full-length enriched cDNA library and expressed sequence tag analysis of the parasitic weed, Striga hermonthica" pot

... Enju A, Akiyama K, Oono Y, Muramatsu M, Hayashizaki Y, Kawai J, Carninci P, Itoh M, Ishii Y, Arakawa T, Shibata K, Shinagawa A, Shinozaki K: Functional annotation of a full-length Arabidopsis cDNA ... hermonthica, and include EST sequences, a comparative analysis with other plant genomes, and useful genetic markers. All the data are stored in a web-based database an...

Ngày tải lên: 12/08/2014, 03:21

10 252 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

... in the biodegradation of a n a lmost unlimited spectrum of natural and man-made organic compounds, among them the tobacco alkaloid nicotine. Perhaps analysed in greatest detail is the pathway of ... the MABO ORF was amplified with the primer pair 5¢-GAC CTGAGTAGAAATGGATCCCTGA TGGACAGG-3¢ and 5¢-GGAATGGCTCGAGGGATCATCACC-3¢ bear- ing the restriction e nzyme recognition...

Ngày tải lên: 19/02/2014, 16:20

8 648 0
Báo cáo khoa học: A di-leucine sorting signal in ZIP1 (SLC39A1) mediates endocytosis of the protein doc

Báo cáo khoa học: A di-leucine sorting signal in ZIP1 (SLC39A1) mediates endocytosis of the protein doc

... ZIP1-Myc(L14 8A, L14 9A) , ZIP1- Myc(V18 2A, L18 3A) , and ZIP1-Myc(Y28 5A) , were gener- ated by QuikChangeÒ II XL site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). The cDNA fragment of IL2RA (amino acids ... exhibits a steady-state localization in the Golgi apparatus and an unknown vesicle com- partment in the stably transfected CHO cells and the disruption...

Ngày tải lên: 16/03/2014, 11:20

12 374 0
báo cáo khoa học: " A matched-pair cluster design study protocol to evaluate implementation of the Canadian C-spine rule in hospital emergency departments: Phase III" ppt

báo cáo khoa học: " A matched-pair cluster design study protocol to evaluate implementation of the Canadian C-spine rule in hospital emergency departments: Phase III" ppt

... Research Institute Ottawa, Ottawa, Canada, 3 Department of Medicine, University of Ottawa, Ottawa, Canada, 4 Divison of Neurosurgery, University of Ottawa, Ottawa, Canada, 5 Department of ... patients per hospital for each of the ''before'' and ''after'' periods in the primary analysis. Because the exact benefits of stratify...

Ngày tải lên: 11/08/2014, 05:22

14 217 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... was partially degraded to cellobiose. Analysis of N-terminal amino-acid sequence, cDNA sequence and deduced amino-acid sequence The N-terminal amino-acid sequence of the purified P. hi- laris ... primers designed from the cDNA sequence resulted in the amplification of bands in each case. Sequencing of these bands showed that they matched the sequence of t...

Ngày tải lên: 17/03/2014, 10:20

6 361 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The ... In the lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately 4 kDa and faint bands at approximately 14 kDa. The band at approximately 14 kDa is...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... Russian/English data. In future work, we plan to adapt our approach to language pairs where one language is alphabetic and the other language is non-alphabetic such as En- glish/Japanese. These language pairs ... the gold standard. Arabic nouns have an article “al” attached to them which is translated in English as the . There are various cases in the training data where an English no...

Ngày tải lên: 19/02/2014, 19:20

9 521 0
Tài liệu Báo cáo khoa học: "A Maximum Expected Utility Framework for Binary Sequence Labeling" doc

Tài liệu Báo cáo khoa học: "A Maximum Expected Utility Framework for Binary Sequence Labeling" doc

... introducing an additional parameter L which limits the number of intermediate states that get expanded. Instead of iterating over all states and their associ- ated probabilities (inner loop starting at ... maps M and N keep track of the algebraic dis- tance from the start state to each intermediate state. On termination of the first outer loop (lines 4–17), the map M cont...

Ngày tải lên: 20/02/2014, 12:20

8 549 0
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

... (Hunston and Francis, 2000) and are collected across the target language. In the fourth and final stage, we exploit C st for bilingual phrase acquisition, rather than a manual dictionary, to achieve ... the participants found TransAhead suggestions satisfying, accepted, and learned from them; c) interactivity made translation and language learning more fun and th...

Ngày tải lên: 22/02/2014, 03:20

4 393 0
Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

... been implicated as the mediator of constitutional t(11;22) translocation in humans [38]. Although there are also a large number of (CA) n and (GA) n repeats in the human genome, the frequency of their ... [46]. The appear- ance of the LIRs probably provides humans with an evolutionary advantage and contributes to the specia- tion of primates. Experimental procedure...

Ngày tải lên: 07/03/2014, 00:20

13 543 0
w