Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

... with the real-time PCR assay and in only 11 samples with a conventional PCR assay. The real-time assay using the TaqMan-system can therefore be practically used for studying the epidemiology and ... NS1 gene. The results of the real-time PCR assays were compared with those of previously established, conventional PCR assays. Materials and metho...

Ngày tải lên: 12/08/2014, 02:20

4 587 0
Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt

Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt

... the metacarpophalangeal joints, and many of the small carpal bones have irregular margins with indentations (for example, at the attachment of ligaments), making discrimination between normal anatomy and presence ... duration 7 years (range 4–22 years)), and three con- trol individuals were female and one was male (median age 36 years (range 34–57 years)). All individuals...

Ngày tải lên: 09/08/2014, 10:23

8 372 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

... Medicine, Animal Care and Use Committee. The rats were cared for in accordance with the Guide for the Care and Use of Laboratory Animals. Statistical analysis The results were recorded by the principal ... control and air leaks when the authors performed recurrent thoracotomy for any reason, and confirmed the efficacy of TachoSil® as an anti-adhesive ag...

Ngày tải lên: 25/10/2012, 11:00

7 453 0
Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx

Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx

... approximately 2% of the with- drawal cases, the cause of cessation was registered as both treatment failure and AE; for these patients, the cause of with- drawal was subsequently classified as an AE. Patients ... activity when comparing infliximab with etanercept, and bias in the withdrawal of patients because of treatment failure is therefore unlikely. Finally,...

Ngày tải lên: 09/08/2014, 08:23

10 502 0
Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf

Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf

... out the bonding experiments and the cytotoxicity assay. JB carried out the analysis of the extracellular matrix content. JF carried out the analysis of the relaxation behaviour and participated ... determined for all substances employed, that is, surface degrading agents and cross-linkers, using the resazurin assay. Taking the favourable cell vitality after treat...

Ngày tải lên: 09/08/2014, 10:20

11 476 0
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

... In Table 1 Basic clinical data, details of arthropathy, serologic findings, and therapy Case Age/gender Clinical presentation and arthropathy Spleen, mm ANA RF IgM, IU/mL ANCA CCP aCL HP Therapy 1 84/F ... Hanna Makuch-Łasica 4 , Mirosław Majewski 4 , Katarzyna Michalak 5 , Robert Rupiński 6 , Krzysztof Warzocha 7 and Renata Maryniak 1 1 Department of Pathomorphology, Institute...

Ngày tải lên: 09/08/2014, 10:23

12 565 0
Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx

Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx

... are very complex and so far no sensitive methods are available for detection of viral and human RNA/DNA in human feces, we have initially tested assay sensitivity for nucleic acid isolation and ... subjects with and without anti-retroviral therapy Ayan K Chakrabarti, Lori Caruso, Ming Ding, Chengli Shen, William Buchanan, Phalguni Gupta, Charles R Rinaldo and Yue Chen* A...

Ngày tải lên: 10/08/2014, 05:21

11 336 0
Báo cáo y học: " Detection of dengue-4 virus in pune, western india after an absence of 30 years - its association with two severe cases" docx

Báo cáo y học: " Detection of dengue-4 virus in pune, western india after an absence of 30 years - its association with two severe cases" docx

... consisting of viruses from Southeast Asia (genotype I), Southeast Asia and the Americas (genotype II), Thailand (genotype III) and Malaysia (Sylvatic) [10]. The 2009 isolate belonged to genotype I or the ... of theseasoninJune2010.Thetwocaseswerehospita- lised patients and underwent standard daily cl inical eva- luation and physical examinations. The case history forms of...

Ngày tải lên: 11/08/2014, 21:22

4 250 0
Báo cáo y học: "Prevalence of porcine circovirus-like agent P1 in Jiangsu, China" docx

Báo cáo y học: "Prevalence of porcine circovirus-like agent P1 in Jiangsu, China" docx

... pmol of forward primer F3 and reverse primer R3, 2.5 mM dNTPs and 0.75U DNA Polymerase. The amplification was performed using a PCR thermal cycler (TaKaRa) and was initiated by heating for 5 ... genome containing overlapping regions to verify. F3: 5-TTAAAGACCCCCCACTTAAACCCTAAATGA-3′, and R3 :5′ - AGTGGGGGGTCTTTAAGATTAAATTCTCTG-3′. (Figure 1). Figure 1 Schematic diagram...

Ngày tải lên: 11/08/2014, 21:22

11 416 0
Báo cáo y học: " Detection of swine transmissible gastroenteritis coronavirus using loop-mediated isothermal amplification" pptx

Báo cáo y học: " Detection of swine transmissible gastroenteritis coronavirus using loop-mediated isothermal amplification" pptx

... CCATCTTCCTTTGAAGTCCA TGEV-FIP Forward Inner 45 CGAGGTCACTGTCACCAAAATT TGATGTGACAAGATTTTATGGAG TGEV-BIP Reverse Inner 42 GGAGCAGTGCCAAGCATTAC AAAATGCTAGACACAGATGGAA TGEV-LF Forward Loop 17 GGCTGAACTGCTTCTAG TGEV-LB ... Fragment; New England Biolabs, USA) with 2 μL total RNA as template. The amplifica- tion was performed at 60°C in a laboratory water bath (Kangle, China, 25°C~99°C, with...

Ngày tải lên: 12/08/2014, 01:21

5 292 0
w