báo cáo khoa học: " A hypothetical correlation between hyaluronic acid gel and development of cutaneous metaplastic synovial cyst" potx

báo cáo khoa học: " A hypothetical correlation between hyaluronic acid gel and development of cutaneous metaplastic synovial cyst" potx

báo cáo khoa học: " A hypothetical correlation between hyaluronic acid gel and development of cutaneous metaplastic synovial cyst" potx

... this article as: Inchingolo et al., A hypothetical correlation between hyaluronic acid gel and development of cutaneous metaplastic synovial cyst Head & Face Medicine 2010, 6:13 This article ... of nasolabial folds. Dermatol Surg 2003, 29:588-95. 3. Friedman PM, Mafong EA, Kauvar AN, Geronemus RG: Safety data of injectable nonanimal stabilized hyaluronic...

Ngày tải lên: 11/08/2014, 20:20

3 292 0
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx

... J., Obama, H., Ozawa, M., Nakayama, T., Maruyama, I., Arima, T. & Muramatsu, T. (1994) Identification of nucleolin as a binding protein for midkine (MK) and heparin- binding growth associated ... was measured in cell extracts as an estimation of the amount of HIV attached to cells. The mean ± SD of triplicate assays of a representative experiment is shown. Table 1. MALDI-TO...

Ngày tải lên: 07/03/2014, 15:20

15 509 0
Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"

Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"

... under fasted condition (8-9 am). Saliva DHEA-S level Approximately 1 ml of saliva was collected in a container, using a plastic straw. A 100 μl aliquot of saliva samples and standards (0, ... the advantage of having a fast degradation rate and can occur in the absence of oxy- gen for rapid ATP resynthesis. Therefore, carbohy- drate storage becomes crucial for surviva...

Ngày tải lên: 31/10/2012, 16:49

7 339 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr...

Ngày tải lên: 18/02/2014, 16:20

14 635 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢. The ... sense strand are listed, as follows: mutation E19 0A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E1...

Ngày tải lên: 18/02/2014, 17:20

12 732 0
Tài liệu Báo cáo khoa học: "A SPEECH-FIRST MODEL FOR REPAIR DETECTION AND CORRECTION" docx

Tài liệu Báo cáo khoa học: "A SPEECH-FIRST MODEL FOR REPAIR DETECTION AND CORRECTION" docx

... glottalization is usually associated with fragments, not all fragments are glottalized. In our database, 62% of fragments are not glottalized, and 9% of glottalized reparanda offsets are ... error repairs and ap- propriateness repairs, statistical analysis does not sup- 6We performed the same analysis for the last and first syllables in the reparandum and repair, respectiv...

Ngày tải lên: 20/02/2014, 21:20

8 502 0
Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc

Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc

... Evaluator E1 is a native Cantonese speaker, E2 a Mandarin speaker, and E3 a speaker of both languages. The results are shown in Figure 6. The average accuracy for all evaluators for both sets ... alignment. Existing lexicon compilation methods (Kupiec 1993; Smadja & McKeown 1994; Kumano & Hirakawa 1994; Dagan et al. 1993; Wu & Xia 1994) all attempt to extract p...

Ngày tải lên: 20/02/2014, 22:20

8 427 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... 956–964. 10 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal a...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA CCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCT...

Ngày tải lên: 07/03/2014, 12:20

16 397 0
Báo cáo khoa học: "A Framework for Unifying Named Entity Recognition and Disambiguation Extraction Tools" pot

Báo cáo khoa học: "A Framework for Unifying Named Entity Recognition and Disambiguation Extraction Tools" pot

... input a URI of a web document that will be analyzed and option- ally an identification of the user for recording and sharing the analysis. 2 Framework NERD is a web application plugged on top of various ... sub- sequently attaches all analysis and evaluations performed by a user with his profile. The scrap- ing module takes as input the URI of an article and extracts its...

Ngày tải lên: 08/03/2014, 21:20

4 466 0
w