Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... 10 6 (10 0%) Guanine PRTFDC1 36 .1 ± 14 .3 2.9 ± 0.7 1. 36 ± 0.34 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) HPRT 9.9 ± 0.2 899 ± 11 7 406 ± 53 4.5 · 10 7 ± 1. 0 · 10 7 (10 0%) M. Welin et al. Studies of the human ... Gene duplication and inactivation in the HPRT gene family. Genomics 89 , 13 4 14 2. 11 Nicklas JA (2006) Pseudogenes of the human HPRT1 gene. Environ M...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... 5859 Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium A. Pappachan 1 , H. S. Savithri 2 and M. R. N. Murthy 1 1 Molecular ... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and Staffan Eriksson 1 1 ... in GTP activation. F133 was mutated to Asn in an attempt to create a GTP-activated enzyme, and F13 3A was prepared and tested as a control. Neither of t...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

... Structural and biochemical characterization of neuronal calretinin domain I II (residues 1 1 00) Comparison to homologous calbindin D 28k domain I II (residues 1 9 3) Małgorzata Palczewska 1 , Patrick ... of CR I II and Calb I II are an indication of different organizations of EF-hands within full-length CR and Calb. CR I II and Calb I...

Ngày tải lên: 22/02/2014, 07:20

9 648 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... portion of the molecule involving a-helix A, the nearby loop, the first and last turns of helices E and F, and the C-terminus helices I and J. In addition, there is a lysine-rich N- and C-ter- minus, ... activation of nuclear transcription factor-jB and the induction of pro -in ammatory pro- duction of cytokines, mainly interleukin (IL)-8 [12]. The activatio...

Ngày tải lên: 06/03/2014, 00:21

9 496 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... localization and I. Birschmann et al. Domain function of Pex1p and Pex6p FEBS Journal 272 (2005) 4758 ê 2004 FEBS 57 Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p Ingvild ... assigned their corresponding binding sites and elucidated the importance of ATP-binding and -hydrolysis of Pex1p and Pex6p...

Ngày tải lên: 07/03/2014, 16:20

12 584 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/ activin pathway Amaury Herpin 1,2 , Christophe ... The C1 and C2 domains appeared to be joined by a ‘linker’ sequence. Also boxed are the transmembrane domain and the serine...

Ngày tải lên: 07/03/2014, 21:20

17 509 0
Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

... previously identified S100 A8 and S100 A9 from pig granulocytes [9] and discovered another member of the S100 family, the S100 A12 [10]. Hofmann et al. [11] proved that S100 A12, and possibly other ... experiments with the calhepatin antibodies followed by SDS/PAGE analysis, only lungfish liver and intestine showed the calhepatin band (data not shown). Fig. 3. Primary st...

Ngày tải lên: 08/03/2014, 22:20

9 445 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efficiency of Iba1 and Iba2 or in the overall morphology of the generated filament bundles. Calcium affinity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional simi- larities and differences between Iba1 and Iba2 . We investigated Ca 2+ binding and homodimerization of Iba1 and...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

... further explore the contribution of these amino acids interacting with the pyrimidine ring to the catalysis of E. coli CMP kinase. Substitution of the side chain from a well-structured protein ... which the short a-heli- cal LID domain, situated in the C-terminal moiety, and the NMP -binding (NMP bind ) domain move in an induced-fit mechanism, closing upon...

Ngày tải lên: 16/03/2014, 10:20

11 437 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

... polysaccharides in a yield of 20% of the LPS mass. Rabbit antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P. penneri ... serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 Zygmunt Sidorczyk 1 , Filip V. Touk...

Ngày tải lên: 17/03/2014, 17:20

6 562 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... with a k max of 343 n m from % 30 l M samples of both untreated (Fig. 4A) Fig. 2. Analysis of antifreeze a ctivity. Antifreeze activity was evaluated qualitatively by monitoring ice crystal morphology ... antifreeze activity (Fig. 2). Equimolar solutions of deglycosylated and untreated smelt AFP displayed similar faceted ice crystal morphology (Fig. 2). The antifreez...

Ngày tải lên: 24/03/2014, 03:21

8 518 0
Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

... specific transcription factors [13,14]. Minireview Structural and functional map of a bacterial nucleoid Agustino Martínez-Antonio*, Alejandra Medina-Rivera † and Julio Collado-Vides † Addresses: ... transcription factors. The next step should be to obtain chromosomal occupancy profiles at different growing phases - that is, lag, early, mid, and late exponential and ear...

Ngày tải lên: 09/08/2014, 20:21

4 307 0
Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... apoE- (72-166) peptides in PBS and also in the presence of DHPC, SE experiments we re performed. The SE and SV data were combined and globally fitted to a multiple discrete species model using SEDPHAT. ... positive ly correlates with the increasing concentration of DHPC. Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and com...

Ngày tải lên: 10/08/2014, 05:21

9 333 0
Báo cáo y học: "Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: a review" ppsx

Báo cáo y học: "Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: a review" ppsx

... Oda M, Kamegaya Y, Yokomori H, Han JY, Akiba Y, Nakamura M, Ishii H, Tsuchiya M: Roles of plasma membrane Ca ++ – ATPase in the relaxation and contraction of hepatic sinusoidal en- dothelial ... 61:222-228 86. Yokomori H, Oda M, Kamegaya Y, Ogi M, Yokono H, Han JY, Akiba Y, Nakamura M, Tsukada N, Ishii H: Functional significance of plasma membrane Ca ++ -ATPase of hepatic...

Ngày tải lên: 13/08/2014, 13:20

17 360 0
w