Báo cáo khoa học: "Purification and characterization of two larval glycoproteins from the cattle tick, Boophilus annulatus" doc

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... here. Purification of four pulchellin isoforms from A. pulchellus seeds Using a combination of affinity, ion exchange and chromatofocusing chromatography, four pulchellin isoforms were isolated from A. pulchellus ... four pulchellin isoforms P. V. Castilho et al. 954 FEBS Journal 27 5 (20 08) 948959 ê 20 08 The Authors Journal compilation ê 20 08 FEBS Isol...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... procedures Isolation of the tyrosinase gene from Trichoderma reesei The tyr2 gene was amplified from genomic T. reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC ... TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC A GT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A. The PCR reaction...

Ngày tải lên: 19/02/2014, 06:20

14 652 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... forward) 45Â-GTATCAGCTTC(C T)TCAAATGTC-3Â PsCBL (degenerate reverse) 55Â-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5ÂUTR forward) 65Â-TTAAGTACTATAAAT-ACACAGCCTA-3Â PsCIPK (3ÂUTR reverse) 75Â-CGAGCTCACTGCCTCTCAAC-3Â ... T)AAGGT-3Â PsCIPK (degenerate forward) 25Â-ACAAA (A C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C G)ACACCACAAGACC)3Â PsCIPK (degenerate reverse) 35Â-CTTAT(C G)AACAAGGAA (A C)AATTTC-3Â...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... for existence of two distinct HSF1 isoforms in rainbow trout and the formation of heterotrimers of these isoforms in vitro. Materials and methods Cell culture and animals Rainbow trout gonadal ... encode distinct isoforms of HSF. Clone C1 was a partial cDNA containing an insert of 983 nucleotides Ó FEBS 2004 Rainbow trout HSF1 (Eur. J. Biochem. 2 71) 70...

Ngày tải lên: 19/02/2014, 12:20

10 539 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... FEBS 5907 Synthesis and characterization of a new and radiolabeled high-affinity substrate for H + /peptide cotransporters Ilka Knu ă tter 1 , Bianka Hartrodt 2 ,Ge za To th 3 , Attila Keresztes 3 , ... Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1). Glycine, which is not a...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition Karuppiah Chockalingam 1, *, James Luba 2, *, Harry S. Nick 3 , David N. Silverman 2 and Huimin ... rela- tionships of human manganese superoxide dismutase. Abbreviations FeSOD, iron superoxide dismutase; hMnSOD, human manganese superox...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... the mistletoe toxic lectin genes. Like other type 2 RIPs (such as ricin and abrin) [2], the mlp genes do not contain introns and they encode the toxic lectins in the form of a single chain precursor ... (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricin B-chain Leu152; and Met234 of the ML1p and ML2...

Ngày tải lên: 07/03/2014, 15:20

11 611 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... domains. The largest domain encompasses strands b1 to b6 a nd strand b7 to the C-terminus. The central b sheet is composed of 7 parallel b strands associated to an anti- parallel strand (b2) and is ... of Rv1399c from M. tuberculosis (Eur. J. Biochem. 271) 3955 Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis...

Ngày tải lên: 07/03/2014, 16:20

9 584 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... (5Â-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3Â), and TG101 (5Â-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3Â) (for the P. horikoshii CoADR), and TG104 (5Â-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3Â) and TG105 (5Â-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3Â) ... constant observed for the CoADR reaction. Thermostability and thermoactivity of the CoADR phCoADR is stable for months at both )80 °C and )20...

Ngày tải lên: 07/03/2014, 17:20

12 420 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

... FEBS proteins were detected in the HD -caveolae and LD -caveolae, particularly in the LD -caveolae, but there was no labelling coinciding with the VHD -caveolae (Fig. 2D). As the sulfo-NHS-biotin reagent ... (Fig. 2G), but increased in response to insulin in both the LD -caveolae and HD -caveolae, with the increase being particularly pronounced in the LD -ca...

Ngày tải lên: 16/03/2014, 13:20

12 460 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... iron- and zinc-containing alcohol dehydrogenase from the hyperthermophilic archaeon Pyrococcus furio- sus. J Bacteriol 181, 1163–1170. 12 Shimizu Y, Sakuraba H, Kawakami R, Goda S, Kaw- arabayasi ... similarity with (putative) TDHs and zinc-containing alcohol de- hydrogenases from archaea and bacteria. Some of the most significant hits of a BLAST search analysis wer...

Ngày tải lên: 16/03/2014, 14:20

8 415 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana Anja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and Jutta Papenbrock Institute for Botany, ... Nagasawa T, Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purificati...

Ngày tải lên: 16/03/2014, 18:20

14 565 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

... FEBS Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding Lucı ´ a Garcia ´ -Ortega 1 , Javier Lacadena 1 , ... Ct -Aspf1 (5Â-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3Â). These primers contained BstEII and BamHI sites and were used to generate a frag...

Ngày tải lên: 16/03/2014, 19:20

9 517 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages Yuichiro Otsuka 1 , Tomonori ... of 18 Ofromradio- labeled water was not observed with guaiacol. It was clear that the b-aryl ether cleavage enzyme catalyzed the add...

Ngày tải lên: 17/03/2014, 03:20

10 671 0
Từ khóa:
w