Báo cáo khoa học " Structure elucidation and antioxidant activity of a novel polysaccharide isolated from Tricholoma matsutake " ppt

Báo cáo khoa học " Structure elucidation and antioxidant activity of a novel polysaccharide isolated from Tricholoma matsutake " ppt

Báo cáo khoa học " Structure elucidation and antioxidant activity of a novel polysaccharide isolated from Tricholoma matsutake " ppt

... 2010 Accepted 19 April 2010 Available online 27 April 2010 Keywords: Polysaccharide structure Antioxidant assay Tricholoma matsutake abstract In this study, structural features of Tricholoma matsutake ... available at ScienceDirect International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac Structure elucidation and antioxidan...

Ngày tải lên: 28/06/2014, 11:20

5 482 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... 3279 Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans Klaus Brandenburg 1 , Frauke Wagner 1 , Mareike Mu¨ ller 1 , Holger Heine 1 ,Jo¨ rg Andra¨ 1 , ... i.e. agonistically as well as antagonistically, completely inactive. The lack of antagonistic activity may be explained by the fact that this lipid A does not intercala...

Ngày tải lên: 21/02/2014, 00:20

9 665 1
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA Bacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL Bicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV 130 ... 4339 Identification and functional characterization of a novel barnacle cement protein Youhei Urushida 1 , Masahiro Nakano 1 , Satoru Matsuda 1 , Naoko Inoue 2 , Satoru Kanai 2 , Na...

Ngày tải lên: 16/03/2014, 05:20

11 488 0
Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf

Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf

... trypsin, and the digests were analyzed by LC-MS ⁄ MS analysis as in [40–42]. Catalytic assay For plasmid substrates, uracil-containing plasmid DNA was prepared by amplification of normal plasmid DNA (pSUPERIOR-puro; ... serum at 1 : 180 000 dilution as primary anti- body, and peroxidase-labeled secondary antibody. Extracts from D. melanogaster and T. castaneum larvae were pre- pared...

Ngày tải lên: 29/03/2014, 08:20

15 413 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

... that lack a capsular structure, which in itself provides serum resistance. Recent data from our laboratory indicate that the ability of acapsular strains of H. influenzae to elaborate sialylated ... Encapsulated strains can cause invasive, bacteraemic infections such as septicemia and strains lacking a capsule, so-called nontypeable strains (NTHi), are a common cause of otitis...

Ngày tải lên: 23/03/2014, 21:21

11 579 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... (Uppsala, Sweden), a ZORBAX 300SB-C18 semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt, ... of conotoxins and their analogs [24–27]. Most NOESY crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of di...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underlin...

Ngày tải lên: 20/02/2014, 23:20

8 511 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... We also found reactivity of some sera to a 9- and a 15-kDa band. We could show that the 9-kDa band in the tomato extracts reacts with a specific antibody against the LTP from cherry, Pru av 3 and ... N-terminal sequence of the mature protein: 5¢TAT GCGTGGTCCAATGCTATGC, and FF 3A, matching with the C-terminal sequence of the coding region: 5¢TTAC AAGGACAAATTAATTGTGCCAG. For...

Ngày tải lên: 21/02/2014, 00:20

11 533 0
Báo cáo khoa học: Improving thermostability and catalytic activity of pyranose 2-oxidase from Trametes multicolor by rational and semi-rational design pdf

Báo cáo khoa học: Improving thermostability and catalytic activity of pyranose 2-oxidase from Trametes multicolor by rational and semi-rational design pdf

... substrate, with the concentration of O 2 as electron acceptor held constant. Kinetic data were determined at 30 °C using the standard ABTS assay and air saturation. Variant D-Glucose D-Galactose K m (mM) ... system (Peqlab, Erlangen, Germany) and using the molecular mass standards High Molecular Weight Calibration Kit for native electrophoresis (Amersham Pharmacia, Piscataway, NJ, USA)...

Ngày tải lên: 07/03/2014, 03:20

17 438 0
Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot

Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot

... Castro-Vazquez A (2005) Control of the seasonal arrest of copulation and spawning in the apple snail Pomacea canaliculata (Prosobranchia: Ampullariidae): differential effects of food availability, water ... Effects of submersion and aerial exposure on clutches and hatchlings of Pomacea canaliculata (Gastropoda: Amp- ullariidae). Am Malacol Bull 20, 55–63. 3 Albrecht EA, Koch...

Ngày tải lên: 07/03/2014, 06:20

9 428 0
w