Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc
... used here as a further indi- cator for the performance of the isolated pig kidney. Materials and methods Animals and experimental groups After approval of the local official veterinarian institu- tions, ... renal anatomy and function, a further advan- tage of porcine organs is based on the availability of organs from commercially slaughtered animals. The use of these...
Ngày tải lên: 20/06/2014, 00:20
... sec). The data was downloaded at the end of each shift and the data used to calculate mean and maximum working heart rates as well as percentage of cardiac Journal of Occupational Medicine and Toxicology ... Day 2 Day 3 Average Heart Rate (beats.min -1 ) AM PM Urine Specific GravityFigure 4 Urine Specific Gravity. Average specific gravity of urine measured at the start...
Ngày tải lên: 20/06/2014, 00:20
... semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt, Germany). Trypsin and tosyl phenylalanyl ... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA Bacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL Bicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV 130 ... 4339 Identification and functional characterization of a novel barnacle cement protein Youhei Urushida 1 , Masahiro Nakano 1 , Satoru Matsuda 1 , Naoko Inoue 2 , Satoru Kanai 2 , Na...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... lic 2A, RM118lpsA and RM118 lgtF before and after treatment with neuraminidase (as indicated by – and +, respectively). The sialylated tetrasaccharide-containing glycoforms are indicated by an asterisk. ... such as septicemia and strains lacking a capsule, so-called nontypeable strains (NTHi), are a common cause of otitis media and acute lower respiratory tract infections [1]....
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc
... modified CYP11B1 was produced by PCR using the 5¢-primer (CGCCATATGGCTACTAAAGCTG CTCGTGTTCCACGTACAGTGCTGCCA) and 3¢-primer (GCGAAGCTTAATGATGATGATGATGATGGTTGAT GGCTCTGAAGGTGAGGAG) and inserted into ... 345–349. 5 Zachmann M, Tassinari D & Prader A (1983) Clinical and biochemical variability of congenital adrenal-hyper- Functional characterization of hCYP11B1 A. Zo ¨ llner et...
Ngày tải lên: 30/03/2014, 04:20
báo cáo hóa học:" Species distribution and antimicrobial susceptibility of gram-negative aerobic bacteria in hospitalized cancer patients" pdf
... pro- vision of study materials or patients, collection and assembly of data, data analysis and interpretation and manuscript writing. All authors read and approved the final manuscript. Acknowledgements We ... susceptibility of gram-negative aerobic bacteria in hospitalized cancer patients Hossam M Ashour* 1 and Amany El-Sharif 2 Address: 1 Department of Microbiology and...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "Future research and therapeutic applications of human stem cells: general, regulatory, and bioethical aspects" ppt
... measures required for manipulation in a clean room. Material and staff flows should be separated and be unidire ctional to minimize cross contamination, and contr ol and documentation of all activities ... cell therapy because of their easy in vitro isolation and expansion and their high capacity to accumulate in sites of tissue damage, inflam- mation, and neoplasia. On...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Factor structure and internal consistency of the 12-item General Health Questionnaire (GHQ-12) and the Subjective Vitality Scale (VS), and the relationship between them: a study from France" potx
... Health Sciences Research, ACECR, Tehran, Iran and 3 Laboratory of Sociology and Anthropology, Departement of Sociology, Rennes II University, France Email: Mareï Salama-Younes - marei.salama@uhb.fr; ... first draft. AI and CR contributed to the study design and the analysis. AM contributed to the analysis and wrote the final manuscript. All authors read and approved the fina...
Ngày tải lên: 18/06/2014, 19:20