... Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antagonist for corticotropin-releasing factor (CRF) receptor, type 2 (CRF 2 ), has been synthesized and characterized. ... with astressin or its photoactivatable analog thus indicating the specificity of the novel photo ligand. It is noteworthy that the N-terminal amino acid D -Phe in antisau...
Ngày tải lên: 31/03/2014, 08:20
... arising in German-Russian Machine Translation with regard to tense and aspect. Since the formal category of aspect is missing in German the information required for generating Rus- sian aspect ... 3. Adverbial Semantics Various types of adverbials may help to arrive at a decision. In cooecurrence with durative, iterative or intensity adverbials (e.g. den ganzen Tag...
Ngày tải lên: 01/04/2014, 00:20
Báo cáo y học: "Changes of uterine blood flow after vaginal radical trachelectomy (VRT) in patients with early-stage uterine invasive cervical cancer"
... Fujii T, Kameyama K, Susumu N, Nakamura M, Iwata T, Aoki D. Abdominal radical trachelectomy as a fertili- ty-sparing procedure in women with early-stage cervical cancer in a series of 61 women. ... Publisher. All rights reserved Research Paper Changes of uterine blood flow after vaginal radical trachelectomy (VRT) in patients with early-stage uterine invasive cervical c...
Ngày tải lên: 25/10/2012, 11:48
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotak...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf
... word of its derivational and inflectional suffixes. Researchers in many areas of computational linguistics and information retrieval find this a desirable step, but for varying reasons. In auto- ... associating re- lated items of information, as they are in an automated library catalogue, and where the catalogue can be in- terrogated in an on-line mode, it seems best t...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx
... introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced into the reverse primer (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facili- tate ... Nivarthi, R. & Devi, L .A. (2001) Oligomerization of opioid receptors with beta 2-adrenergic receptors: a role in trafficking and mitogen-activated protein kinase activatio...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khóa học: Development of recombinant inhibitors specific to human kallikrein 2 using phage-display selected substrates docx
... rACT 8.20 ,5¢-TACCGCGGTCAAAATCACCCTCC GTTCTCGAGCAGTGGAGACGCGTGA-3¢;rACT 6.3 , 5¢-TACCGCGGTCAAAATCACC AGGAGGTCTATC GATGTGGAGACGCGTGA-3¢;rACT 8.3 ,5¢-TACCGCG GTCAAAATC AGGGGGAGATCTGAGTTAGTGGA GACGCGTGA-3¢;rACT 6.7 ,5¢-TACCGCGGTCAAAAT C AAGCTTAGAACAACATTAGTGGAGACCGCTG A- 3¢;rACT 6.1 ,5¢-TACCGCGGTCAAAATCATGACAA GATCTAACTTAGTGGAGACGCGTGA-3¢;rACT 5.18 , 5¢-TACCGCGGTCAAAATCACC GAGCGTGTCTCG CCCGTGGA...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: "Development of Computational Linguistics Research: a Challenge for Indonesia" pptx
... rest are either names or foreign words. Detailed analysis can be found in Muhadjir (1996). 2 KBBI (Kamus Besar Bahasa Indonesia), the standard word dictionary for Bahasa Indonesia, contains a ... an important means as a way to understand the evolution of language usage by its people. In the case of Bahasa Indonesia, research activities on corpus analysis were almost none. The...
Ngày tải lên: 17/03/2014, 07:20
Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc
... structure of a- syn showed that a- syn homodimers can adopt nonpropagating (head -to- tail) and propagating (head -to- head) conformations. Propagating a- syn dimers on the membrane incorporate additional a- syn ... (aa) protein, and b-syn is a 134-aa protein. Each of the synucleins is composed of an N-terminal lipid-binding domain containing 11 residue repeats and a C-terminal...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... this article as: Lindström et al.: Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators. Scandinavian Journal of Trauma, Resuscitation ... feedback to the EMD with a code explaining the reason for not transporting the patient to the hospital. The ambulances have a nine- point classification syst...
Ngày tải lên: 25/10/2012, 10:02