Báo cáo hóa học: " Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" docx

Báo cáo khoa học: "Automatic Assessment of Coverage Quality in Intelligence Reports" doc

Báo cáo khoa học: "Automatic Assessment of Coverage Quality in Intelligence Reports" doc

... domain, and will necessarily impact the as- sessment of coverage, since we have no means of determining whether an analyst has included all the relevant information to which she, in partic- ular, ... viewed as a summarization task. In fact, a high quality report shares many of the charac- teristics of a good document summary. In par- ticular, it seeks to cover as much of...

Ngày tải lên: 23/03/2014, 16:20

5 372 0
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

... in vitro data suggest that the proline-rich fragments of C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2. [We have also found an in vivo association ... Caskin1 fragments As described in the introductory paragraphs, the N-terminal half of Caskin1 contains a number of well-known domains involved in protein–protein inter- acti...

Ngày tải lên: 16/03/2014, 02:20

13 408 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot

Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot

... evaluating the relevance of the glyoxalase pathway as a potential therapeutic target by revealing the importance of critical parameters of this pathway in Leishma- nia infantum. A sensitivity analysis ... FEBS Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation Marta Sousa Silva 1 , Anto ´ ni...

Ngày tải lên: 23/03/2014, 13:20

11 515 0
Báo cáo y học: "Ocular manifestations of Lyme borreliosis in Europe"

Báo cáo y học: "Ocular manifestations of Lyme borreliosis in Europe"

... T. What kind of clinical, epidemiological, and biological data is essential for the diagnosis of lyme borreliosis? Derma- tological and ophthalmological courses of Lyme borreliosis. Médecine ... with Lyme arthritis. Br J Ophhalmol 1999; 83:1149-1152 2. Mikkila HO, Seppala IJT, Viljanen MK, Peltomaa MP, Karma A. The expanding clinical spectrum of ocular Lyme borreliosis. Ophthal...

Ngày tải lên: 03/11/2012, 11:11

2 366 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

... precipitation of a- lactalbumin commenced after 25 min and reached a plateau after 90 min. The amount of DTT-induced aggregation of a- lactalbumin was increased in a concentration-dependent manner ... different target proteins (e.g. whilst Arg-HCl at 250 mm had little effect on the aggregation of insulin or a- synucleinA53T alone, it dramatically increased the aggregation of...

Ngày tải lên: 18/02/2014, 16:20

13 613 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... for critical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, Antonella Antignani and Sonia Di Gaetano for preparing some of the RNase variants used in this ... is lack- ing, this residue was modeled using the 7RSA structure as template. Protein–lipidic membrane complexes of RNase AA, RNase AA-G, RNase AA-GG, and HHP-RNase were prepared using...

Ngày tải lên: 19/02/2014, 06:20

11 644 0
Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

... Fushman D, Varadan R, Assfalg A & Walker O (2004) Determining domain orientation in macromolecules by using spin-relaxation and residual dipolar coupling mea- surements. Prog Nuclear Magnetic ... CaMKII and CaMKIV, respectively), CaM kinase kinase (CaMKK), titin kinase, and death associated kinase [4]. Structural studies on CaMKI [5], titin kinase [6] and twitchin kinase [7] have up...

Ngày tải lên: 19/02/2014, 17:20

12 591 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

... evidence that N-glycans, in particular their terminal structures, are involved in regulating the GABA translocation of GAT1, but not in binding of GAT1 to GABA. Transport of GABA by GAT1 across the ... chains of GAT1 in uence the affinity of GAT1 for GABA, concentra- tion dependencies were analyzed on the basis of the Michaelis–Menten equation V ¼ V max GABA ½GABA K m GABA...

Ngày tải lên: 19/02/2014, 17:20

14 655 0
Tài liệu Báo cáo khoa học: Improving Classification of Medical Assertions in Clinical Notes" pdf

Tài liệu Báo cáo khoa học: Improving Classification of Medical Assertions in Clinical Notes" pdf

... label using instances with that label as positive instances and instances with any other label as negative instanc- es. The final class label is assigned by choosing the class that was assigned ... 2005. Automa- tion of a Problem List Using Natural Language Pro- cessing. BMC Med Inform Decis Mak, 5:30. Guergana K. Savova, James J. Masanz, Philip V. Ogren, Jiaping Zheng, Sunghwan...

Ngày tải lên: 20/02/2014, 05:20

6 496 0
w