Báo cáo khoa học: "Semantic Links on a Thesaurus*" pdf
... References AGROVOC. 1995. Thdsaurus Agricole Multi- lingue. Organisation de Nations Unies pour l'Alimentation et l'Agriculture, Roma. Roberto Basili, Maria Teresa Pazienza, and Paola Velardi. ... language in (Jacquemin, 1999). Let us illustrate variant extraction on a sample variation: 5 Nt Prep N2 -+ M(N1,N) Adv ? A ? Prep_Ar.t ? A ? S(N2) Through this pattern,...
Ngày tải lên: 31/03/2014, 04:20
... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and...
Ngày tải lên: 18/02/2014, 11:20
... infor- mation data set harvested from the databases avail- able on the web, e.g., Wikipedia and Google Map. A- data consists of 1, 603 sentences with 317 word types. The second type of data, called ... maximum approximation for summation, (1) can be written as A ∗ t = arg max A Ω W P r (A, W|U t , H t ) ≈ arg max A Ω max W P r (A, W|U t , H t ) = arg max A Ω,W P r(W|U t , H t )P r (...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... Preparation of mitochondria from animal tissues and yeasts. In Subcellular components. Preparation and Fractionation (Birnie, G.D., ed.), pp. 77–91. Butterworths, London. 38. Gornall, A. G., Bardawill, ... membrane potential; mitochondria; mitochond- rial DNA; targeting. Mammalian mitochondrial DNA (mtDNA) encodes 13 polypeptides and the RNA machinery for their transcrip- tion and translatio...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx
... Events, and Relations An important property of a natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. ... of ACTION called ACTION-BY-JACK, i.e., (27) (28) SUBTYPE(ACTION-BY-JACK,ACTIONS) ¥ abj:ACTION-BY-JACK ROLE(abj,ACTOR,JACK). Then we could encode the general fact that all actions b...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx
... tTGAAACA 0.27 c AaGAAACA 0.14 ATaAAACA 0.81 ATcAAACA 0.03 c ATtAAACA 0.01 c ATGcAACA 0.69 ATGgAACA 0.20 c I ATGAgACA 0.02 c ATGAAgCA 0.05 c ATGAAAgA 0.30 III ATGAAACg 0.26 a PREs represented in the ... a significant Table 1. RCS of mutant PREs for binding of wild-type Ste12 to a PRE consensus (ATGAAACA) in vitro. FUS1 PRE a Sequence RCS b II ATGAAACA 1.00 IV tTGAAACA 0.27 c AaGAAACA 0....
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... an action noun, an object-action relation is also regarded as a semantic-role relation. On the other hand, in the agent, posses- sion and belonging relations, N1 and N2 have a weaker relationship. ... analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 1998). Then, a genus w...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
... gold-standardand automatically assigned POS. We review related research in Section 5, and formu- late our conclusions in Section 6. 2 Task representation, data preparation, and experimental setup We ... a shallow parsing task as our benchmark task. If, to support an application such as infor- mation extraction, summarization, or question an- swering, we are only interested in parts of the p...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... – L-Gulono-c-lactone oxidase [145] N 1 Animal VAO – L-Gluconolactone oxidase [146] N 3 Fungus VAO – L-Galactonolactone oxidase [147] N 1 Yeast VAO – D-Arabinono-1,4-lactone oxidase [148] Yeast VAO – Sorbitol ... This artifi- cial covalent flavinylation (again, FAD is linked via an 8-carbon rather than 8a- carbon linkage) resulted in an increased k cat value with d-alanine from 1.5 s )1 for the...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Tumour necrosis factor-a attenuates insulin action on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells pptx
... protein assay kit (Biorad Laboratories). Densitometric analysis Each band, when mentioned, was analysed by alpha digi- doc 1201 software (Alpha Innotech Corporation, San Leandro, CA, USA). The same ... on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells Amit K. Pandey, Vikash Bhardwaj* and Malabika Datta Inst...
Ngày tải lên: 16/03/2014, 02:20