Geometric algebra and its application to mathematical physics c doran

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... GTTAGCTACGGCACTAAAAGG This study PAO462 Candidatus ‘Accumulibacter phosphatis’ CCGTCATCTACWCAGGGTATTAAC Crocetti et al . (2000) PAO651 Candidatus ‘Accumulibacter phosphatis’ CCCTCTGCCAAACTCCAG Crocetti ... (2000) PAO846 Candidatus ‘Accumulibacter phosphatis’ GTTAGCTACGGCACTAAAAGG Crocetti et al. (2000) EUB338 Most eubacteria GCTGCCTCCCGTAGGAGT Amann et al . (1995) EUB338 II Planctomycetales G...

Ngày tải lên: 05/09/2013, 09:38

7 720 0
Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt

Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt

... quadruple- choice, in case the system cannot answer the question, random choice can be performed to improve the cov- erage to 100%. Thus, for each knowledge resource we compared cases without/with random ... im- proved the coverage for the Nichigai dictionary, but decreased the accuracy. However, by combining both resources, the accuracy was noticeably improved, and the coverage was com...

Ngày tải lên: 20/02/2014, 18:20

8 509 1
Tài liệu Báo cáo khoa học: "AUTOMATIC SPEECH RECOGNITION AND ITS APPLICATION TO INFORMATION EXTRACTION" pdf

Tài liệu Báo cáo khoa học: "AUTOMATIC SPEECH RECOGNITION AND ITS APPLICATION TO INFORMATION EXTRACTION" pdf

... automatic speech recognition will continue to find applications, such as meeting/conference summarization, automatic closed captioning, and interpreting telephony. It is expected that speech ... furui@cs.titech.ac.jp ABSTRACT This paper describes recent progress and the author's perspectives of speech recognition technology. Applications of speech recognition technology ca...

Ngày tải lên: 20/02/2014, 18:20

10 515 3
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

... 0.00 51 Acetoac-CoA + Succ fi acetoac + Succ-CoA 100 Acetoacetate-succinyl-CoA transferase 2.8.3.5 0.00 52 Crot-CoA fi 3HB-CoA 6 D -crotonase 4.2.1.17 0.00 53 L3HB-CoA fi crot-CoA 6 L -crotonase 4.2.1.17 ... PEP carboxykinase 4.1.1.32 0.00 PHB synthesis and acetyl-CoA conversion pathway 46 2 acetyl-CoA fi acetoac-CoA + CoA 1 b-ketothiolase 2.3.1.16 5.56 47 Acetoac-CoA + NADPH fi 3HB-CoA + NADP 1...

Ngày tải lên: 07/03/2014, 15:20

18 800 0
Báo cáo khoa học: "Bayesian Synchronous Tree-Substitution Grammar Induction and its Application to Sentence Compression" pdf

Báo cáo khoa học: "Bayesian Synchronous Tree-Substitution Grammar Induction and its Application to Sentence Compression" pdf

... following θ t+1 c, e = n c, e + α − 1 n c, . + Kα − K where n c, e represents the expected count of rule c → e, and K is the total number of ways to rewrite c, we now take into account our DP(α c , P 0 (· | c) ) ... 2003. Statistical sentence condensa- tion using ambiguity packing and stochastic disam- biguation methods for lexical-functional grammar. In NAACL ’03: Proceedings...

Ngày tải lên: 07/03/2014, 22:20

11 424 0
Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx

Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx

... from Constraint 2, defined in Section 3.2. 4.3 Cycle A cycle 3 shows the existence of a topic. In V, {dT, ds, dg, dl0} is a cycle for the topic "statement." By recognizing cycles, ... Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting Naohiko Uramoto and Koichi Takeda IBM Research, Tokyo Research Laboratory 1623-14 Shimo-tsuruma, Yama...

Ngày tải lên: 08/03/2014, 06:20

7 419 0
Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx

Báo cáo khoa học: "Generalized Encoding of Description Spaces and its Application to Typed Feature Structures" potx

... Encoding of Description Spaces and its Application to Typed Feature Structures Gerald Penn Department of Computer Science University of Toronto 10 King's College Rd. Toronto M5S 3G4, Canada Abstract This ... special case of promoting the type of a single TFS to a subtype, the type only needs to be trailed. If cyclic TFSs are not supported, then acyclicity must also be enforce...

Ngày tải lên: 08/03/2014, 07:20

8 456 0
Báo cáo khoa học: "Revision Learning and its Application to Part-of-Speech Tagging" pptx

Báo cáo khoa học: "Revision Learning and its Application to Part-of-Speech Tagging" pptx

... learning. Section 6 discusses related works, and Section 7 gives conclusion. 2 Multi-Class Classification Problems and the One-versus-Rest Method Let us consider the problem to decide the class of ... binary classifier with higher capacity to revise the errors made by the stochastic model with lower capacity as fol- lows: During the training phase, a ranking is assigned to each class...

Ngày tải lên: 17/03/2014, 08:20

8 499 0
Báo cáo khoa học: "Detection of Quotations and Inserted Clauses and its Application to Dependency Structure Analysis in Spontaneous Japanese" doc

Báo cáo khoa học: "Detection of Quotations and Inserted Clauses and its Application to Dependency Structure Analysis in Spontaneous Japanese" doc

... obtained when correct sentence boundaries are given We investigated the clause boundary detection accuracy of quotations and inserted clauses and the dependency accuracy when correct sentence boundaries ... Although the accuracy of detecting the boundaries of quotations and inserted clauses us- ing automatically analyzed dependency structure was not high, the accuracy of dependency stru...

Ngày tải lên: 23/03/2014, 18:20

7 386 0
w