Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... Tanaka K, Kawai M, Tainaka K, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encoding gene from the marine bacterium Alteromonas sp. strain O-7. Gene ... of the catalytic domain are under- lined. The preregion is indicated in red, the pro-region in black, catalytic domain in blue and the C-terminal domains in violet. The ass...

Ngày tải lên: 19/02/2014, 07:20

... that brominated fatty acid and ASA both associated with W81 in the same ligand binding site. The ligand binding activity of ASP3c was further investigated using displacement of ASA, a fatty acid ... recombinant protein. Binding of ligands assessed by the intrinsic tryptophan fluorescence The recombinant protein appeared therefore quite amena- ble to ligand -binding st...

Ngày tải lên: 21/02/2014, 03:20

... sequence, confirming that the N-terminal Met and Ala were indeed absent. Although cleavage of the terminal Met was not unexpected, the loss of the alanine residue was initially surprising. However, the literature ... alternative pathways are avail- able, it is unlikely to play any significant role in the catabolism of the branched-chain amino acids or of methionine. Iden...

Ngày tải lên: 06/03/2014, 00:21

... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACG...

Ngày tải lên: 07/03/2014, 16:20

... Norway Haemerythrin proteins comprise a family of O 2 -carrry- ing proteins mainly found in a few phyla of marine invertebrates. Members of this family differ from haemoglobin and haemocyanin in that they ... The amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3, 141–147. 43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino ac...

Ngày tải lên: 07/03/2014, 17:20

... known as a seed albumin [5], it was named PA1b for pea albumin 1b. PA1b is the result of the post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide (PA 1a) . PA1b ... binding of PA1b to a proteinaceous component of a particulate fraction of S. oryzae extracts. The binding was saturable and reversible, and the bin...

Ngày tải lên: 08/03/2014, 02:21

... concentrations. SEM values were calculated by fitting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA, L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, ... Bmo AAX39866 Tni APN4 AAK69605 Sli AAF37559 Hpu APN2 AAK58066 Hvi AAC36148 Pin AAX39865 Tni APN3 AAF01259 Pxy APN3 Q11000 Hvi AAN75694 Har APN2 AAF37560 Hpu APN3 AAF99701 Epo AAD31183 Ldi A...

Ngày tải lên: 16/03/2014, 12:20

... pH 7.2, containing 0.1 m NaCl. The reaction was started by the addition of 0.2 lg enzyme. The initial rate was determined by measuring the increase in A 346 , the isobestic point of the p-nitrophenol ... 2387 Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis Puja Shahi* † , Ish Kumar* ‡ , Ritu Sharma, Shefali Sanger and Ravinder S...

Ngày tải lên: 16/03/2014, 13:20

... 5’-TGC CCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletion CAT1 5’-CGC GGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacement CAT2 5’-GC TCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacement PRTI 5’-CAATTGACCAGCCTTGAGCA-3’ ... in vitro against a synthetic substrate RRA(pT)VA. Mutations in the invariant aspartate resi- dues implicated in the metal binding completely abolished PhpP acti...

Ngày tải lên: 16/03/2014, 18:20

... our results that argue for a membrane DPP III in insects when it is mainly identified as a cytosolic peptidase in mammals. Furthermore, the analysis of the orientation of the two putative transmembrane ... to a Pharmacia AKTA FPLC system (Pharmacia, Uppsala, Sweden) delivering 5 mLÆmin )1 . The cartridge was then rinsed with Hepes buffer (con- taining 0.1% w/v Chaps fo...

Ngày tải lên: 17/03/2014, 10:20