Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc

... Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein Jonas S. Johansson 1,2,4 , Gavin A. Manderson 1 , Roberto Ramoni 5 , Stefano Grolli 5 and ... exchange [19] was used to evaluate the effect of bound halothane and isoflurane on global protein dynamics, with the goal of further defining a potentia...

Ngày tải lên: 07/03/2014, 16:20

... [40], R max ðtheoreticalÞ¼ðM r;analyte =M r;ligand Þn A R immobilized ð1Þ where M r,analyte and M r,ligand are the relative molecular mass of the analyte and ligand, respectively; n is the number of analyte -binding ... association and dissociation are near the limit of being too fast to be analysed quantitatively with confidence. Thus, the response values at the ste...

Ngày tải lên: 30/03/2014, 11:20

... B2-linker-ATTGTAACGGCTATATCTACTGG ALR-c36SU3¢ B2-linker-GGCAAGAAGCTCGAAATAACC ALR-c63SU3¢ B2-linker-CCAATAGCTGGCCAAGAACC ALR-c96SU3¢ B2-linker-ATTCATACCGAAAAGACC C ALR2-HIS-f ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC ALR2-HIS-r ... ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC ALR2-HIS-r AAAGATCTGCCGACCTACCATAGCGGTC ATGTTAATTGTAACGGCATCGATGAATT CGAG...

Ngày tải lên: 19/02/2014, 06:20

... Methanosarcina acetivorans C 2A (A) Q8TIT8_METAC AAM07401.1 378 MA4052 (a- amylase) ND Methanosarcina acetivorans C 2A (A) Q8TIT9_METAC AAM07400.1 396 MM0861 (a- amylase) ND Methanosarcina mazei ... understanding of the functionality of the potentially valuable, heat stable GH-57 enzymes, especially that of the T. hydrothermalis amylopullulanase, the present work has focused o...

Ngày tải lên: 19/02/2014, 12:20

... introduced the main features of the UAM CorpusTool, software for human and semi-automatic annotation of text and images. The demonstration will show how to set up an annotation project, how to annotate ... In the last 20 years, a number of tools have been developed to facilitate the human annotation of text. These have been necessary where software for aut...

Ngày tải lên: 20/02/2014, 09:20

... EDTA, 2 mm NaN 3 ,4mm glutathione, 10 units of GR and 0.8 mm NADPH in a total volume of 195 lL. After incubation, H 2 O 2 was added to a final concentration of 10 mm as substrate for the GPx, and ... to have excel- lent radical scavenger and antioxidant properties in model reactions that are superior to those of other fruit and plant extracts and other antioxidant...

Ngày tải lên: 30/03/2014, 02:20

... plasmid pADC-8 as tem- plate and the forward and reverse primers pNeo 1 (5¢- CCGGAATTCTGAATGAACTGCAGGACGAGGCAG-3¢) and pNeo 2 (5¢-CCGGAATTCCGGCCATTTTCCACCAT GATATTC-3¢), respectively. The labelled ... correspond to parasites harvested at the early logarithmic phase of growth, and ADC activity values are the average of assays carried out in duplicate. Transformed parasite...

Ngày tải lên: 19/02/2014, 07:20

... PA-oligosaccharides, GalNAca1-3(Fuca1-2)Galb1-3(Fuca1-4)GlcNAcb1-3Galb1- 4Glc-PA and Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1- 6(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2- 6Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4Glc- NAc-PA ... Tetrasialyl PA glycan Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1-6(Neu5- Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2-6Galb1- 4GlcNAcb1-2)Ma na1-3)Manb1-4GlcNAcb1-4GlcNA-PA...

Ngày tải lên: 18/02/2014, 14:20

... of the same size and similar ATPase activities, K m ATP values of 120 lm and 200 lm and k cat values of 74 ATPÆmin )1 and 77 ATPÆmin )1 (per MDL1 subunit), respectively. The ATPase activity of ... accessibility assays and post-transla- tional modifications revealed that the NBD and the highly positively charged N-terminus of mature MDL1 are located in the mitoch...

Ngày tải lên: 18/02/2014, 16:20

... the DNA binding of the protein. The DNA -binding ability of these alanine-substituted Rad51 mutants was evaluated by a gel retardation tech- nique and by measurements of the DNA-dependent ATPase ... 2006 The Authors Journal compilation ª 2006 FEBS 3159 Roles of the human Rad51 L1 and L2 loops in DNA binding Yusuke Matsuo 1 , Isao Sakane 2 , Yoshimasa Takizawa 1...

Ngày tải lên: 19/02/2014, 06:20