Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... 19051–19058. 59. MacRae, T.H. & Liang, P. (1998) Molecular characterization of p26, a cyst-specific, small heat shock /a- crystallin protein from Artemia franciscana. Arch. Hydrobiol. 52, 3 93–409. 60. Sambrook, ... understanding the functional mechanisms of small h eat s hock /a- crystallin proteins. Keywords: small heat shock /a- crystallin protein; oligomeri- z...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf
... plasmid specific primers (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc. All other chemicals were of analy- tical grade or higher quality. Animals, ... enzymes. Statistical analysis Results represent mean ± SEM (n ‡ 4). Data were statis- tically evaluated by Analysis of Variance ( ANOVA ), followed by Newman-Keuls-Student’s test. P-...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt
... 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTC ATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or 5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG TTTACAAGCTG-3¢) ... 5¢-AAGC TTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC TTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGG ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and 5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAA...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... similarities with several products from the pur cluster of S. alboniger [6]. They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7. The two additional ones were named ata12 and ataPKS1 ... moiety of A2 0 1A and puromycin by S. capreolus and S. alboniger, respectively. Considering that most, if not all, of the genes between ard1 and ard2 are part of the ata cluster, ata...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: Kinetic study of sn-glycerol-1-phosphate dehydrogenase from the aerobic hyperthermophilic archaeon, Aeropyrum pernix K1 potx
... Ishikawa 1 1 National Institute of Advanced Industrial Science and Technology, Ikeda, Osaka, Japan; 2 National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki, Japan A gene h aving ... a rchaea; g lycerol-1-phosphate dehydrogenase; ordered bi–bi mechanism; hyperther- mophile. Archaea are a phylogenetically distinct group that diverged from eubacteria and...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... of phenylalanine ammonia-lyase und 4-coumarate:CoA ligase in oat primary leaves. Z. Naturforsch. 36 c, 389–395. 5. Grand, C., Boudet, A. & Boudet, A. M. (1983) Isoenzymes of hydroxycinnamate:CoA ... 5¢-CGGATGCCGATTTTGTGGAGG-3¢ 4CL1-KpnI5¢-GCT GGTACCGCACCTTCTCCACAAG-3¢ 4CL1-S1 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢ 4CL1-S2 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 4CL3-HindIII 5¢-GTTCT AAGCTTTTAAGGC...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... Smalas AO & Willassen NP (2003) The structure of uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr Sect D 59, 1357–1365. 10 Aghajari ... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Greenblat...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
... with a spectrofluorometer FP750 (JASCO Co., Tokyo, Japan). Assay of lipase and esterase activities Acrylodated intestinal fatty acid binding protein (ADI FAB; FFA science LLC, San Diego, CA, USA) ... cells by adding heparin to the media, was assayed for catalytic activity. The lipase (A) and esterase (B) activities of the substituted mutants, R40 5A, K41 3A, K41 3A/ K41 4A, K41 4A, an...
Ngày tải lên: 21/02/2014, 15:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... 4919 Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia ... plasmid containing human a- synuclein cDNA (a- syn). As a control, we used SH-SY 5Y cells stably transfected with the plasmid containing b-galactosidase cDNA (b-gal). West...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... Bxe _A2 876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA ... sequences of Dke1 and a structurally characterized cupin protein from Rubrivivax gelatinosus PM1 (Protein Data Bank identifier: 2O1Q) that has been functionally annotated as acetyl...
Ngày tải lên: 18/02/2014, 06:20