Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A...

Ngày tải lên: 19/02/2014, 07:20

19 707 0
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... follows: HSF 1a forward, 5¢-GAAGCAGCTTGTCCAGTACACCAA-3¢; HSF 1a reverse, 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢; HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACAC CTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGC CAGTAGC-3¢; ... to extract total RNA for RT-PCR, were obtained from the Nikko Branch of the National Research Institute of Aquaculture (Tochigi, Japan) and reared on a commercial diet at 15 °C....

Ngày tải lên: 19/02/2014, 12:20

10 539 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereas agglutination was inhibited by galactose and its deriva- tives [such as N-acetylgalactosamine (GalNAc), methyl -a- d-galactopyranoside], it was evident...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified ... T. reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC A GT GGT...

Ngày tải lên: 19/02/2014, 06:20

14 652 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... complex than in T cells, with several peaks of nuclease hyper- sensitivity [85]. Mast cells express GATA-2 as well as NFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ... typically recruit HATs such as SAGA and NuA3, which mainly acety- late histone H3, and NuA4 which acetylates histone H4 on K5, K8 and K12. This cascade of events leads to rec...

Ngày tải lên: 14/02/2014, 18:20

29 743 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a ... cycle Cell survival miR-278 Site1: Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCU site2: Expanded UTR 5´ AGAUGGUAAAAUACACGAG CC...

Ngày tải lên: 14/02/2014, 19:20

9 684 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; c...

Ngày tải lên: 18/02/2014, 04:20

11 653 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... properties and has a value of 0.5; if no similarity exists, the parameter has a value of 1 Polarity change If the mutant causes polarity or charge changes. Change equals unity and no change equals zero Conservation ... energy parame- ters are partly correlated, as are conservation and accessibility, and secondary structure and accessibility. The four parameters that reflect a...

Ngày tải lên: 18/02/2014, 11:20

14 562 0
Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

... 153–208. 37 Kawahara T, Kohjima M, Kuwano Y, Mino H, Teshima-Kondo S, Takeya R, Tsunawaki S, Wada A, Sumimoto H & Rokutan K (2005) Helicobacter pylori lipopolysaccharide activates Rac1 and transcription ... The intensities of immunoreactive bands for HA-Noxo1b and HA-Noxo1c in (B) were quantified using a LAS-1000plus (Fuji film) image analyzer and expressed as the fold increase...

Ngày tải lên: 19/02/2014, 06:20

15 633 0
Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx

Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx

... Molecular and biochemical characterisation of two aspartic proteinases TcAP1 and TcAP2 from Theobroma cacao seeds. Planta 215, 754–762. 12. Park, H., Yamanaka, N., Mikkonen, A. , Kusakabe, I. & Kobayashi, ... distributed among families A1 , A3 , A1 1 and A1 2 of clan AA, and family A2 2 of clan AD. The majority of plant APs belongs to the A1 family, together with...

Ngày tải lên: 19/02/2014, 12:20

9 605 0
w