Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT...

Ngày tải lên: 19/02/2014, 06:20

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a ... filter paper assay and tritium-labeled substrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. k cat was calculated using M w (HPRT) = 2...

Ngày tải lên: 15/02/2014, 01:20

... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined ... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car-...

Ngày tải lên: 18/02/2014, 08:20

... [29] agrees with the large body of independent data collected on Calb and truncated Calbs by Kumar’s group. This latter work revealed that EF-hands II and VI of Calb do not bind calcium and that ... Groves 1 , Attila Ambrus 2, *, Agata Kaleta 1 , Katalin E. Ko¨ve ´ r 3 , Gyula Batta 4 and Jacek Kuz ´ nicki 1,5 1 Department of Molecular and Cellular Neurobiology, Nencki Institu...

Ngày tải lên: 22/02/2014, 07:20

... suggest that K eq A and the associated k on and k off conforma- tional rates are primary factors in regulating the cyto- chrome c reductase activity of NOS enzymes, particularly in the CaM-free state. Do ... done to obtain measures of K eq A and the associated k 1 and k 2 values for dual-flavin enzymes, particularly when they are poised in all catalytically relevant intermediat...

Ngày tải lên: 18/02/2014, 11:20

... The binary complex has a characteristic p-p charge transfer (CT) absorbance and NAD(P)H binding and dissocia- tion can be measured by following the formation of this CT absorbance at, for example, ... cur- rently available, it appears that it is appropriate to describe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions may be a large reor...

Ngày tải lên: 18/02/2014, 11:20

... cysteines located in both of the large PSI subunits, PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE are located at the cytosolic site (Fig. 1A) [2,7,13–16]. ... ferredoxin- NADP + reductase in Anabaena PCC. Biochemistry 42, 2036–2045. 90 Casaus JL, Navarro JA, Herva ´ s M, Lostao A, De la Rosa MA, Go ´ mez-Moreno C, Sancho J &...

Ngày tải lên: 18/02/2014, 11:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid...

Ngày tải lên: 18/02/2014, 14:20

... Essential genes of a minimal bacte- rium. Proc Natl Acad Sci USA 103, 425–430. 12 Yamanaka K, Ogura T, Niki H & Hiraga S (1992) Identification and characterization of the smbA gene, a suppressor ... Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin 1 , Martin Welin 2, *, Liya Wang 1 and...

Ngày tải lên: 18/02/2014, 16:20

... to an open reading frame (ORF) of EhPGDH was amplified by PCR using a cDNA library [26] as a template, and oligonucleotide primers (5¢-caGGATCCaagatagttgtgataac cga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), ... from Gly and Ala from Cys and conversions between Asp and Asn and between Glu and Gln [49]. Serine metabolic pathways are often absent in parasitic protists; the...

Ngày tải lên: 19/02/2014, 13:20